Transcript: Human NR_135296.1

Homo sapiens DEAD-box helicase 19A (DDX19A), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Homo sapiens (human)
Gene:
DDX19A (55308)
Length:
2796
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135296.1
NBCI Gene record:
DDX19A (55308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229839 GCAGATACCAATGGTATTATC pLKO_005 257 3UTR 100% 13.200 18.480 N DDX19A n/a
2 TRCN0000218102 GTTATGACCAAGGGAATTATG pLKO_005 2258 3UTR 100% 13.200 9.240 N DDX19A n/a
3 TRCN0000218489 AGAAACACGAAAGTCTGAATC pLKO_005 2022 3UTR 100% 10.800 7.560 N DDX19A n/a
4 TRCN0000050221 GATGACCAATTTGCAGATCAA pLKO.1 220 3UTR 100% 4.950 3.465 N DDX19A n/a
5 TRCN0000050218 GCTGTCAAGTCGATGACCAAT pLKO.1 209 3UTR 100% 4.950 3.465 N DDX19A n/a
6 TRCN0000229838 TCAAGTCGATGACCAATTTGC pLKO_005 213 3UTR 100% 4.950 3.465 N DDX19A n/a
7 TRCN0000153815 CACAGGAGACAAGTGCATTTA pLKO.1 1426 3UTR 100% 13.200 7.920 N DDX19A n/a
8 TRCN0000154790 GCACAGGAGACAAGTGCATTT pLKO.1 1425 3UTR 100% 10.800 6.480 N DDX19A n/a
9 TRCN0000050222 CCCAAATGTTATCAAACTGAA pLKO.1 815 3UTR 100% 4.950 2.970 N DDX19A n/a
10 TRCN0000156033 CGGCAGAAGTAGAGAGAAACT pLKO.1 1479 3UTR 100% 4.950 2.970 N DDX19A n/a
11 TRCN0000050220 CGCGGCATTGATGTTGAACAA pLKO.1 1125 3UTR 100% 4.950 2.475 Y DDX19A n/a
12 TRCN0000151004 GATTTGGACGAGATTGAGAAA pLKO.1 1350 3UTR 100% 4.950 2.475 Y DDX19A n/a
13 TRCN0000155545 CCAGAAGATCAGTGAGCAGAT pLKO.1 560 3UTR 100% 4.050 2.025 Y DDX19A n/a
14 TRCN0000155474 GCACAGCATGAACATCCTGAA pLKO.1 1280 3UTR 100% 4.050 2.025 Y DDX19A n/a
15 TRCN0000152824 GAATCCTGACAATGAGACCTA pLKO.1 1190 3UTR 100% 2.640 1.320 Y DDX19A n/a
16 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 2434 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03576 pDONR223 100% 40.3% None 1_163del;549_550ins218;1380_2796del n/a
2 ccsbBroad304_03576 pLX_304 0% 40.3% V5 1_163del;549_550ins218;1380_2796del n/a
3 TRCN0000472365 CATCTACGCACTTAACAACACTCT pLX_317 29.8% 40.3% V5 1_163del;549_550ins218;1380_2796del n/a
4 ccsbBroadEn_02663 pDONR223 100% 39% None (many diffs) n/a
5 ccsbBroad304_02663 pLX_304 0% 39% V5 (many diffs) n/a
6 TRCN0000472192 ATGCACTATTTATGCCGATATGCA pLX_317 32.3% 39% V5 (many diffs) n/a
7 ccsbBroadEn_02664 pDONR223 100% 34.5% None (many diffs) n/a
8 ccsbBroad304_02664 pLX_304 0% 34.5% V5 (many diffs) n/a
9 TRCN0000492319 TCACCATTCCTGCGTCCACGACGC pLX_317 2.8% 34.5% V5 (many diffs) n/a
Download CSV