Transcript: Human NM_001320526.1

Homo sapiens DEAD-box helicase 19A (DDX19A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
DDX19A (55308)
Length:
3140
CDS:
740..1726

Additional Resources:

NCBI RefSeq record:
NM_001320526.1
NBCI Gene record:
DDX19A (55308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229839 GCAGATACCAATGGTATTATC pLKO_005 257 5UTR 100% 13.200 18.480 N DDX19A n/a
2 TRCN0000218102 GTTATGACCAAGGGAATTATG pLKO_005 2602 3UTR 100% 13.200 9.240 N DDX19A n/a
3 TRCN0000218489 AGAAACACGAAAGTCTGAATC pLKO_005 2366 3UTR 100% 10.800 7.560 N DDX19A n/a
4 TRCN0000229840 ATATGAGCTGGCGCTTCAAAC pLKO_005 799 CDS 100% 10.800 7.560 N DDX19A n/a
5 TRCN0000050221 GATGACCAATTTGCAGATCAA pLKO.1 220 5UTR 100% 4.950 3.465 N DDX19A n/a
6 TRCN0000050218 GCTGTCAAGTCGATGACCAAT pLKO.1 209 5UTR 100% 4.950 3.465 N DDX19A n/a
7 TRCN0000229838 TCAAGTCGATGACCAATTTGC pLKO_005 213 5UTR 100% 4.950 3.465 N DDX19A n/a
8 TRCN0000050219 CCAGAACTGAAGCTTGCCTAT pLKO.1 854 CDS 100% 4.050 2.835 N DDX19A n/a
9 TRCN0000153815 CACAGGAGACAAGTGCATTTA pLKO.1 1770 3UTR 100% 13.200 7.920 N DDX19A n/a
10 TRCN0000154790 GCACAGGAGACAAGTGCATTT pLKO.1 1769 3UTR 100% 10.800 6.480 N DDX19A n/a
11 TRCN0000050222 CCCAAATGTTATCAAACTGAA pLKO.1 1159 CDS 100% 4.950 2.970 N DDX19A n/a
12 TRCN0000156033 CGGCAGAAGTAGAGAGAAACT pLKO.1 1823 3UTR 100% 4.950 2.970 N DDX19A n/a
13 TRCN0000050220 CGCGGCATTGATGTTGAACAA pLKO.1 1469 CDS 100% 4.950 2.475 Y DDX19A n/a
14 TRCN0000151004 GATTTGGACGAGATTGAGAAA pLKO.1 1694 CDS 100% 4.950 2.475 Y DDX19A n/a
15 TRCN0000155545 CCAGAAGATCAGTGAGCAGAT pLKO.1 904 CDS 100% 4.050 2.025 Y DDX19A n/a
16 TRCN0000155474 GCACAGCATGAACATCCTGAA pLKO.1 1624 CDS 100% 4.050 2.025 Y DDX19A n/a
17 TRCN0000152824 GAATCCTGACAATGAGACCTA pLKO.1 1534 CDS 100% 2.640 1.320 Y DDX19A n/a
18 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 2778 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02664 pDONR223 100% 86.3% 87.5% None (many diffs) n/a
2 ccsbBroad304_02664 pLX_304 0% 86.3% 87.5% V5 (many diffs) n/a
3 TRCN0000492319 TCACCATTCCTGCGTCCACGACGC pLX_317 2.8% 86.3% 87.5% V5 (many diffs) n/a
4 ccsbBroadEn_03576 pDONR223 100% 68.6% 68.6% None 0_1ins450 n/a
5 ccsbBroad304_03576 pLX_304 0% 68.6% 68.6% V5 0_1ins450 n/a
6 TRCN0000472365 CATCTACGCACTTAACAACACTCT pLX_317 29.8% 68.6% 68.6% V5 0_1ins450 n/a
7 ccsbBroadEn_02663 pDONR223 100% 66.7% 67.6% None (many diffs) n/a
8 ccsbBroad304_02663 pLX_304 0% 66.7% 67.6% V5 (many diffs) n/a
9 TRCN0000472192 ATGCACTATTTATGCCGATATGCA pLX_317 32.3% 66.7% 67.6% V5 (many diffs) n/a
Download CSV