Transcript: Human XM_017030296.1

PREDICTED: Homo sapiens leukocyte immunoglobulin-like receptor subfamily B member 3 (LOC107987462), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-09
Taxon:
Homo sapiens (human)
Gene:
LOC107987462 (107987462)
Length:
2238
CDS:
112..2010

Additional Resources:

NCBI RefSeq record:
XM_017030296.1
NBCI Gene record:
LOC107987462 (107987462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056784 GTGGAGGTTCACATGCTATTA pLKO.1 684 CDS 100% 13.200 6.600 Y LILRB3 n/a
2 TRCN0000056783 TGACCAGAGAAAGACTGATTT pLKO.1 1536 CDS 100% 13.200 6.600 Y LILRB3 n/a
3 TRCN0000419260 TGGTGGCAGTTTGACACTTTC pLKO_005 1153 CDS 100% 10.800 5.400 Y LILRB3 n/a
4 TRCN0000060502 GACACTTTCCTTCTGACCAAA pLKO.1 1165 CDS 100% 4.950 2.475 Y LILRA6 n/a
5 TRCN0000056787 GCTCATAAGTACCAGGCTGAA pLKO.1 1231 CDS 100% 4.050 2.025 Y LILRB3 n/a
6 TRCN0000056785 GTCACAGCAAACACAGGACAT pLKO.1 1514 CDS 100% 4.050 2.025 Y LILRB3 n/a
7 TRCN0000060501 GACAGAAATAACCCACTGGAA pLKO.1 319 CDS 100% 2.640 1.320 Y LILRA6 n/a
8 TRCN0000417376 CCACACCTGGTCTGGGAAGAT pLKO_005 1412 CDS 100% 1.650 0.825 Y LILRB3 n/a
9 TRCN0000056786 CCTCCGATGTGGCTCACAGAA pLKO.1 534 CDS 100% 1.650 0.825 Y LILRB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11582 pDONR223 100% 98.6% 97.6% None (many diffs) n/a
2 ccsbBroad304_11582 pLX_304 0% 98.6% 97.6% V5 (many diffs) n/a
3 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 98.6% 97.6% V5 (many diffs) n/a
4 ccsbBroadEn_07695 pDONR223 100% 80.9% 71.4% None (many diffs) n/a
5 ccsbBroad304_07695 pLX_304 0% 80.9% 71.4% V5 (many diffs) n/a
6 TRCN0000477615 ACCTCCGGAGCACCCTCCTCATAA pLX_317 20.9% 80.9% 71.4% V5 (many diffs) n/a
7 ccsbBroadEn_14983 pDONR223 54.7% 74.4% 63.7% None (many diffs) n/a
8 ccsbBroad304_14983 pLX_304 0% 74.4% 63.7% V5 (many diffs) n/a
9 TRCN0000479724 AATACAGTCTCGATGTATTCGCGG pLX_317 36% 41.6% 34.9% V5 (many diffs) n/a
10 ccsbBroadEn_07723 pDONR223 100% 58.4% 50.3% None (many diffs) n/a
11 ccsbBroad304_07723 pLX_304 0% 58.4% 50.3% V5 (many diffs) n/a
12 TRCN0000478308 ATCGACTTCGATGCCTGGACTCCC pLX_317 25% 58.4% 50.3% V5 (many diffs) n/a
Download CSV