Transcript: Human NM_000141.4

Homo sapiens fibroblast growth factor receptor 2 (FGFR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
FGFR2 (2263)
Length:
4654
CDS:
648..3113

Additional Resources:

NCBI RefSeq record:
NM_000141.4
NBCI Gene record:
FGFR2 (2263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147365 GATAGCCATTTACTGCATAG pXPR_003 GGG 1147 47% 9 0.576 FGFR2 FGFR2 76183
2 BRDN0001148071 GCCGGCAAATGCCTCCACAG pXPR_003 TGG 802 33% 7 0.5712 FGFR2 FGFR2 76182
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000141.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219679 TTAGTTGAGGATACCACATTA pLKO.1 726 CDS 100% 13.200 18.480 N FGFR2 n/a
2 TRCN0000231051 TTAGTTGAGGATACCACATTA pLKO_005 726 CDS 100% 13.200 18.480 N FGFR2 n/a
3 TRCN0000196699 GTTCTCTATATTCGGAATGTA pLKO.1 1623 CDS 100% 5.625 7.875 N FGFR2 n/a
4 TRCN0000000368 CCGAATGAAGAACACGACCAA pLKO.1 1841 CDS 100% 2.640 3.696 N FGFR2 n/a
5 TRCN0000194817 CGTTGTTCCTTCTGTACTAAA pLKO.1 4417 3UTR 100% 13.200 10.560 N FGFR2 n/a
6 TRCN0000231052 GCCGTGATCAGTTGGACTAAG pLKO_005 849 CDS 100% 10.800 8.640 N FGFR2 n/a
7 TRCN0000218493 AGCCCTGTTTGATAGAGTATA pLKO_005 2666 CDS 100% 13.200 9.240 N FGFR2 n/a
8 TRCN0000231053 ATATGGATCAGAGGAGTAAAT pLKO_005 3214 3UTR 100% 13.200 9.240 N FGFR2 n/a
9 TRCN0000321949 ATATGGATCAGAGGAGTAAAT pLKO_005 3214 3UTR 100% 13.200 9.240 N Fgfr2 n/a
10 TRCN0000000370 GCCAACCTCTCGAACAGTATT pLKO.1 2965 CDS 100% 13.200 9.240 N FGFR2 n/a
11 TRCN0000219680 TGGAGTACTCCTATGACATTA pLKO.1 2398 CDS 100% 13.200 9.240 N FGFR2 n/a
12 TRCN0000257217 TGGAGTACTCCTATGACATTA pLKO_005 2398 CDS 100% 13.200 9.240 N FGFR2 n/a
13 TRCN0000321950 TGGAGTACTCCTATGACATTA pLKO_005 2398 CDS 100% 13.200 9.240 N Fgfr2 n/a
14 TRCN0000000367 GCCACCAACCAAATACCAAAT pLKO.1 758 CDS 100% 10.800 7.560 N FGFR2 n/a
15 TRCN0000194830 CAGTGAAACTTGGTACTTCAT pLKO.1 989 CDS 100% 4.950 3.465 N FGFR2 n/a
16 TRCN0000000366 GCACACACTTACAGAGCACAA pLKO.1 3457 3UTR 100% 4.050 2.835 N FGFR2 n/a
17 TRCN0000000369 CCCAACAATAGGACAGTGCTT pLKO.1 888 CDS 100% 2.640 1.848 N FGFR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000141.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491520 TTTCTTCGCCTCATCTCCCTTGTC pLX_317 7.9% 99.7% 99.7% V5 (not translated due to prior stop codon) 696A>G;1282_1287delGTAACA n/a
2 TRCN0000492076 ACTGTTTAAGGCTAGTTTATGATC pLX_317 16.5% 99.6% 99.6% V5 696A>G;1282_1287delGTAACA;2463_2464insG n/a
3 ccsbBroadEn_14640 pDONR223 0% 96.7% 96.7% None (many diffs) n/a
4 ccsbBroad304_14640 pLX_304 0% 96.7% 96.7% V5 (many diffs) n/a
5 TRCN0000465402 CTAGCGAGATACATAGTTCGCTAC pLX_317 9.6% 96.7% 96.7% V5 (many diffs) n/a
6 TRCN0000488178 TTTGGGGCAGTGGTGCCCTACGGC pLX_317 9.8% 96.7% 96.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489718 CGCCACTACCTCAGAATTGCTGAT pLX_317 16.4% 96.7% 96.6% V5 (many diffs) n/a
8 TRCN0000491431 CTCACCCCTTCATGGGAGAACTCG pLX_317 12.9% 96.2% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_06211 pDONR223 100% 85.7% 85.6% None 110_454del;696A>G;1282_1287delGTAACA n/a
10 ccsbBroad304_06211 pLX_304 0% 85.7% 85.6% V5 110_454del;696A>G;1282_1287delGTAACA n/a
11 TRCN0000487708 AAGTTCAAGTCTTTTTGTAGGCCG pLX_317 15.7% 46.7% 46.7% V5 (not translated due to prior stop codon) 1_1311del n/a
Download CSV