Transcript: Human NM_001039397.2

Homo sapiens TBC1 domain family member 28 (TBC1D28), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
TBC1D28 (254272)
Length:
1978
CDS:
413..1045

Additional Resources:

NCBI RefSeq record:
NM_001039397.2
NBCI Gene record:
TBC1D28 (254272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245868 GCATATAACCCTGTGAGTATT pLKO_005 947 CDS 100% 13.200 9.240 N TBC1D28 n/a
2 TRCN0000245872 TCACCGTGTTTCATGCTATTT pLKO_005 1769 3UTR 100% 13.200 9.240 N TBC1D28 n/a
3 TRCN0000245871 GGGTGTTGCAACTTCTTGAAA pLKO_005 1027 CDS 100% 5.625 3.938 N TBC1D28 n/a
4 TRCN0000245869 ATTCACAGGCATGGGTGTCTC pLKO_005 1002 CDS 100% 4.050 2.835 N TBC1D28 n/a
5 TRCN0000245870 GTACCTGTGCCCATATTCACA pLKO_005 988 CDS 100% 0.000 0.000 N TBC1D28 n/a
6 TRCN0000118514 CGTGGCCTATTCTGCATATAA pLKO.1 934 CDS 100% 15.000 7.500 Y TBC1D26 n/a
7 TRCN0000118515 CCCAGGCAAATATAAGGTCAT pLKO.1 784 CDS 100% 4.050 2.025 Y TBC1D26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09898 pDONR223 100% 99.8% 99.5% None 167A>C n/a
2 ccsbBroad304_09898 pLX_304 0% 99.8% 99.5% V5 167A>C n/a
3 TRCN0000477885 TTTCCCCCCGACATGCCATGGAAT pLX_317 50.5% 99.8% 99.5% V5 167A>C n/a
4 ccsbBroadEn_10062 pDONR223 100% 76.4% 73.7% None (many diffs) n/a
5 ccsbBroad304_10062 pLX_304 0% 76.4% 73.7% V5 (many diffs) n/a
6 TRCN0000471493 CACCGGATCCAACTCAATTTTTTG pLX_317 58.4% 76.4% 73.7% V5 (many diffs) n/a
7 ccsbBroadEn_13009 pDONR223 100% 11.9% 10.9% None (many diffs) n/a
8 ccsbBroad304_13009 pLX_304 0% 11.9% 10.9% V5 (many diffs) n/a
9 TRCN0000476936 CGGTACTGGGGTTGGAATGCGCAC pLX_317 100% 11.9% 10.9% V5 (many diffs) n/a
Download CSV