Transcript: Human NM_001040172.2

Homo sapiens 5-hydroxytryptamine receptor 4 (HTR4), transcript variant d, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
HTR4 (3360)
Length:
1238
CDS:
48..1130

Additional Resources:

NCBI RefSeq record:
NM_001040172.2
NBCI Gene record:
HTR4 (3360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009115 CGCCTTCTTGAATAAGTCTTT pLKO.1 983 CDS 100% 4.950 6.930 N HTR4 n/a
2 TRCN0000009117 CGGCTATATCAATTCCGGGTT pLKO.1 947 CDS 100% 2.160 3.024 N HTR4 n/a
3 TRCN0000356466 CCCTCTGCGCATCGCATTAAT pLKO_005 449 CDS 100% 15.000 12.000 N HTR4 n/a
4 TRCN0000356545 CACGTTTCTCTCGACGGTTAT pLKO_005 116 CDS 100% 10.800 8.640 N HTR4 n/a
5 TRCN0000356469 TGGAATAACATTGGCATAATT pLKO_005 528 CDS 100% 15.000 10.500 N HTR4 n/a
6 TRCN0000356467 CTCATGGTGCTGGCCTATTAC pLKO_005 666 CDS 100% 13.200 9.240 N HTR4 n/a
7 TRCN0000009116 CCTATAATGCAAGGCTGGAAT pLKO.1 513 CDS 100% 4.950 3.465 N HTR4 n/a
8 TRCN0000009114 GCACCATTCTTTGTCACCAAT pLKO.1 864 CDS 100% 4.950 3.465 N HTR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488893 GTTCTTTGTCAGGGTACTATTGAA pLX_317 29.3% 92.5% 92.5% V5 (not translated due to prior stop codon) 1077_1079delATTinsGGA;1080_1081ins84 n/a
2 TRCN0000488651 AGCATCTACCCAGGGCGTAGTTTG pLX_317 30.8% 92.4% 92.2% V5 1077_1079delATTinsGGA;1080_1081ins85 n/a
Download CSV