Transcript: Human NM_001080409.3

Homo sapiens zinc finger protein 99 (ZNF99), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF99 (7652)
Length:
7861
CDS:
136..2730

Additional Resources:

NCBI RefSeq record:
NM_001080409.3
NBCI Gene record:
ZNF99 (7652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230531 TAGCCATTTCTCACGCCTTAC pLKO_005 3534 3UTR 100% 6.000 4.200 N ZNF99 n/a
2 TRCN0000230530 CTAGGGAGAAATCGTACAAAT pLKO_005 2989 3UTR 100% 13.200 7.920 N ZNF99 n/a
3 TRCN0000218110 ACAATTCCTCAACCCTTAGAA pLKO_005 2531 CDS 100% 5.625 3.375 N ZNF99 n/a
4 TRCN0000230529 ACTGGAAAGAAACCCTATAAA pLKO_005 2485 CDS 100% 15.000 7.500 Y ZNF99 n/a
5 TRCN0000230528 AGACATGAGATGGTAACTAAA pLKO_005 334 CDS 100% 13.200 6.600 Y ZNF99 n/a
6 TRCN0000160536 CTCAACCCTTATGAAACATAA pLKO.1 942 CDS 100% 13.200 6.600 Y ZNF708 n/a
7 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1226 CDS 100% 13.200 6.600 Y ZNF138 n/a
8 TRCN0000243748 CTGGAAAGAAACCCTACAAAT pLKO_005 1142 CDS 100% 13.200 6.600 Y Gm6871 n/a
9 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1058 CDS 100% 13.200 6.600 Y Zfp934 n/a
10 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1058 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
11 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1058 CDS 100% 13.200 6.600 Y EG668616 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5927 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 1025 CDS 100% 4.950 2.475 Y ZNF681 n/a
14 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5880 3UTR 100% 4.950 2.475 Y LOC387873 n/a
15 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 1048 CDS 100% 4.950 2.475 Y ZNF702P n/a
16 TRCN0000423291 ACTGGAAAGAAACCCTATAAG pLKO_005 2485 CDS 100% 13.200 6.600 Y Zfp677 n/a
17 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 3688 3UTR 100% 4.950 2.475 Y ZNF714 n/a
18 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 1048 CDS 100% 4.950 2.475 Y ZNF321P n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5927 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09784 pDONR223 100% 52.1% 42.7% None (many diffs) n/a
2 ccsbBroad304_09784 pLX_304 0% 52.1% 42.7% V5 (many diffs) n/a
3 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 52.1% 42.7% V5 (many diffs) n/a
4 ccsbBroadEn_11384 pDONR223 100% 8.2% 7.3% None (many diffs) n/a
5 ccsbBroad304_11384 pLX_304 0% 8.2% 7.3% V5 (many diffs) n/a
6 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 8.2% 7.3% V5 (many diffs) n/a
7 ccsbBroadEn_15729 pDONR223 0% 8.1% 7.2% None (many diffs) n/a
8 ccsbBroad304_15729 pLX_304 0% 8.1% 7.2% V5 (many diffs) n/a
9 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 8.1% 7.2% V5 (many diffs) n/a
Download CSV