Transcript: Human NM_001144916.1

Homo sapiens fibroblast growth factor receptor 2 (FGFR2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
FGFR2 (2263)
Length:
4103
CDS:
442..2562

Additional Resources:

NCBI RefSeq record:
NM_001144916.1
NBCI Gene record:
FGFR2 (2263)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219679 TTAGTTGAGGATACCACATTA pLKO.1 520 CDS 100% 13.200 18.480 N FGFR2 n/a
2 TRCN0000231051 TTAGTTGAGGATACCACATTA pLKO_005 520 CDS 100% 13.200 18.480 N FGFR2 n/a
3 TRCN0000196699 GTTCTCTATATTCGGAATGTA pLKO.1 1072 CDS 100% 5.625 7.875 N FGFR2 n/a
4 TRCN0000000368 CCGAATGAAGAACACGACCAA pLKO.1 1290 CDS 100% 2.640 3.696 N FGFR2 n/a
5 TRCN0000194817 CGTTGTTCCTTCTGTACTAAA pLKO.1 3866 3UTR 100% 13.200 10.560 N FGFR2 n/a
6 TRCN0000218493 AGCCCTGTTTGATAGAGTATA pLKO_005 2115 CDS 100% 13.200 9.240 N FGFR2 n/a
7 TRCN0000231053 ATATGGATCAGAGGAGTAAAT pLKO_005 2663 3UTR 100% 13.200 9.240 N FGFR2 n/a
8 TRCN0000321949 ATATGGATCAGAGGAGTAAAT pLKO_005 2663 3UTR 100% 13.200 9.240 N Fgfr2 n/a
9 TRCN0000000370 GCCAACCTCTCGAACAGTATT pLKO.1 2414 CDS 100% 13.200 9.240 N FGFR2 n/a
10 TRCN0000219680 TGGAGTACTCCTATGACATTA pLKO.1 1847 CDS 100% 13.200 9.240 N FGFR2 n/a
11 TRCN0000257217 TGGAGTACTCCTATGACATTA pLKO_005 1847 CDS 100% 13.200 9.240 N FGFR2 n/a
12 TRCN0000321950 TGGAGTACTCCTATGACATTA pLKO_005 1847 CDS 100% 13.200 9.240 N Fgfr2 n/a
13 TRCN0000000366 GCACACACTTACAGAGCACAA pLKO.1 2906 3UTR 100% 4.050 2.835 N FGFR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06211 pDONR223 100% 99.6% 99.7% None 351A>G;937_942delGTAACA n/a
2 ccsbBroad304_06211 pLX_304 0% 99.6% 99.7% V5 351A>G;937_942delGTAACA n/a
3 TRCN0000491520 TTTCTTCGCCTCATCTCCCTTGTC pLX_317 7.9% 85.7% 85.6% V5 (not translated due to prior stop codon) 109_110ins345;351A>G;937_942delGTAACA n/a
4 TRCN0000492076 ACTGTTTAAGGCTAGTTTATGATC pLX_317 16.5% 85.6% 85.5% V5 (many diffs) n/a
5 ccsbBroadEn_14640 pDONR223 0% 82.9% 82.6% None (many diffs) n/a
6 ccsbBroad304_14640 pLX_304 0% 82.9% 82.6% V5 (many diffs) n/a
7 TRCN0000465402 CTAGCGAGATACATAGTTCGCTAC pLX_317 9.6% 82.9% 82.6% V5 (many diffs) n/a
8 TRCN0000488178 TTTGGGGCAGTGGTGCCCTACGGC pLX_317 9.8% 82.8% 82.6% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489718 CGCCACTACCTCAGAATTGCTGAT pLX_317 16.4% 82.8% 82.5% V5 (many diffs) n/a
10 TRCN0000491431 CTCACCCCTTCATGGGAGAACTCG pLX_317 12.9% 82.7% 81.2% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000487708 AAGTTCAAGTCTTTTTGTAGGCCG pLX_317 15.7% 54.3% 54.3% V5 (not translated due to prior stop codon) 1_966del n/a
Download CSV