Transcript: Human NM_001190837.1

Homo sapiens dynactin subunit 1 (DCTN1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
DCTN1 (1639)
Length:
4497
CDS:
319..4134

Additional Resources:

NCBI RefSeq record:
NM_001190837.1
NBCI Gene record:
DCTN1 (1639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063970 GCTGGAGACATTGAATCAATT pLKO.1 3762 CDS 100% 13.200 9.240 N DCTN1 n/a
2 TRCN0000299622 GCTGGAGACATTGAATCAATT pLKO_005 3762 CDS 100% 13.200 9.240 N DCTN1 n/a
3 TRCN0000063971 CCAGAGACCTTTGACTTCAAA pLKO.1 1945 CDS 100% 5.625 3.938 N DCTN1 n/a
4 TRCN0000299565 CCAGAGACCTTTGACTTCAAA pLKO_005 1945 CDS 100% 5.625 3.938 N DCTN1 n/a
5 TRCN0000063969 GCCCAGGAGAAGTTTGAACTA pLKO.1 2173 CDS 100% 4.950 3.465 N DCTN1 n/a
6 TRCN0000299620 GCCCAGGAGAAGTTTGAACTA pLKO_005 2173 CDS 100% 4.950 3.465 N DCTN1 n/a
7 TRCN0000063968 GCCCATCTACAGGATGTGAAT pLKO.1 1870 CDS 100% 4.950 2.970 N DCTN1 n/a
8 TRCN0000299621 GCCCATCTACAGGATGTGAAT pLKO_005 1870 CDS 100% 4.950 2.970 N DCTN1 n/a
9 TRCN0000063972 GCCATCAAGTACTATCAGCAT pLKO.1 2464 CDS 100% 2.640 1.584 N DCTN1 n/a
10 TRCN0000299623 GCCATCAAGTACTATCAGCAT pLKO_005 2464 CDS 100% 2.640 1.584 N DCTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06086 pDONR223 100% 89.4% 89% None (many diffs) n/a
2 ccsbBroad304_06086 pLX_304 0% 89.4% 89% V5 (many diffs) n/a
3 TRCN0000491671 CGGCAGCGCTTACGCACGCAAGAA pLX_317 8% 89.4% 89% V5 (many diffs) n/a
4 ccsbBroadEn_10771 pDONR223 100% 15.5% 15.4% None 1_3220delinsA n/a
5 ccsbBroad304_10771 pLX_304 0% 15.5% 15.4% V5 1_3220delinsA n/a
6 TRCN0000471305 ATTAACCCGCCAATCATTCTCCCT pLX_317 76.3% 15.5% 15.4% V5 1_3220delinsA n/a
Download CSV