Transcript: Mouse NM_001191027.1

Mus musculus dynein cytoplasmic 1 intermediate chain 1 (Dync1i1), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dync1i1 (13426)
Length:
2658
CDS:
308..2101

Additional Resources:

NCBI RefSeq record:
NM_001191027.1
NBCI Gene record:
Dync1i1 (13426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001191027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089626 GCTGGTGTATAATAAGTCCAA pLKO.1 1456 CDS 100% 2.640 3.696 N Dync1i1 n/a
2 TRCN0000424148 ATATGAAGCCAGATATGATTG pLKO_005 2448 3UTR 100% 10.800 7.560 N DYNC1I1 n/a
3 TRCN0000089627 CATCTTCTTTGACCGGACAAT pLKO.1 856 CDS 100% 4.950 3.465 N Dync1i1 n/a
4 TRCN0000089624 CGTCAGTTCTACGATGAACAT pLKO.1 992 CDS 100% 4.950 3.465 N Dync1i1 n/a
5 TRCN0000089623 GCTGTATTTAATAGCTGGAAA pLKO.1 2374 3UTR 100% 4.950 3.465 N Dync1i1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001191027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15399 pDONR223 0% 86.8% 93.4% None (many diffs) n/a
2 ccsbBroad304_15399 pLX_304 0% 86.8% 93.4% V5 (many diffs) n/a
3 TRCN0000466291 ACTAATTGATGGCGTAAGAATCCG pLX_317 17.2% 86.8% 93.4% V5 (many diffs) n/a
4 ccsbBroadEn_06111 pDONR223 100% 86.4% 92.8% None (many diffs) n/a
5 ccsbBroad304_06111 pLX_304 0% 86.4% 92.8% V5 (many diffs) n/a
6 TRCN0000474666 ACAAAAGTCTGGCCGGTCAGATAC pLX_317 28.5% 86.4% 92.8% V5 (many diffs) n/a
7 ccsbBroadEn_06110 pDONR223 100% 86.4% 92.9% None (many diffs) n/a
8 ccsbBroad304_06110 pLX_304 0% 86.4% 92.9% V5 (many diffs) n/a
9 TRCN0000474539 GTATGAACGGGGAGATCAGTGTAC pLX_317 26.3% 86.4% 92.9% V5 (many diffs) n/a
10 TRCN0000489183 ACCGTTATATTTCTCCACCACGAA pLX_317 16.4% 86.4% 92.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV