Transcript: Human NM_001193273.2

Homo sapiens RB binding protein 5, histone lysine methyltransferase complex subunit (RBBP5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
RBBP5 (5929)
Length:
4308
CDS:
431..1663

Additional Resources:

NCBI RefSeq record:
NM_001193273.2
NBCI Gene record:
RBBP5 (5929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329737 GCTGTAATGATGGCCGAATTG pLKO_005 174 5UTR 100% 10.800 15.120 N RBBP5 n/a
2 TRCN0000353567 TGGAGCCGAGATGGTCATAAA pLKO_005 269 5UTR 100% 13.200 10.560 N RBBP5 n/a
3 TRCN0000165444 GCCACCTAAGAAGAAACCCAA pLKO.1 1387 CDS 100% 2.640 2.112 N RBBP5 n/a
4 TRCN0000165777 CGTGAGTGCTTCCACTGATAA pLKO.1 292 5UTR 100% 13.200 9.240 N RBBP5 n/a
5 TRCN0000329678 TCATTGTACCCAGCGTCATTT pLKO_005 1990 3UTR 100% 13.200 9.240 N RBBP5 n/a
6 TRCN0000369175 TTTCAAGCATAAGTCCAAATA pLKO_005 1855 3UTR 100% 13.200 9.240 N RBBP5 n/a
7 TRCN0000369176 ACCCATCATAGCATCCATTTC pLKO_005 970 CDS 100% 10.800 7.560 N RBBP5 n/a
8 TRCN0000418649 GTCACAGTGGGATGTTCTTTC pLKO_005 319 5UTR 100% 10.800 7.560 N Rbbp5 n/a
9 TRCN0000159189 GCAGATCGAATAATCAGAGTT pLKO.1 701 CDS 100% 4.950 3.465 N RBBP5 n/a
10 TRCN0000329677 GCAGATCGAATAATCAGAGTT pLKO_005 701 CDS 100% 4.950 3.465 N RBBP5 n/a
11 TRCN0000034413 GCCTTCTGTAGCAGTGATGAA pLKO.1 1202 CDS 100% 4.950 3.465 N Rbbp5 n/a
12 TRCN0000034410 GCTCTATTGTATTTACCCATT pLKO.1 1241 CDS 100% 4.050 2.835 N Rbbp5 n/a
13 TRCN0000166086 CCACGAGATCAGAACAAGGTT pLKO.1 398 5UTR 100% 3.000 2.100 N RBBP5 n/a
14 TRCN0000159776 GTAAAGAGAAAGATTCTCCAT pLKO.1 1524 CDS 100% 2.640 1.848 N RBBP5 n/a
15 TRCN0000161384 GCTTCCAGAGATGGAAACAAA pLKO.1 2439 3UTR 100% 0.563 0.394 N RBBP5 n/a
16 TRCN0000431475 AGAGAAAGATTCTCCATTTAA pLKO_005 1528 CDS 100% 15.000 9.000 N Rbbp5 n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4099 3UTR 100% 10.800 5.400 Y SMIM11A n/a
18 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2974 3UTR 100% 4.950 2.475 Y ERAP2 n/a
19 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2975 3UTR 100% 13.200 6.600 Y LIAS n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3931 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3931 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3931 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3933 3UTR 100% 4.950 2.475 Y CFLAR n/a
24 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3933 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06848 pDONR223 100% 76.1% 76.2% None 0_1ins381;57G>A;1204_1205insCAG n/a
2 TRCN0000475189 CATTTCTGTCCGGTTCTTCAGACT pLX_317 21.1% 76.1% 76.2% V5 0_1ins381;57G>A;1204_1205insCAG n/a
Download CSV