Transcript: Human NM_001256426.1

Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
PDLIM5 (10611)
Length:
6219
CDS:
182..2059

Additional Resources:

NCBI RefSeq record:
NM_001256426.1
NBCI Gene record:
PDLIM5 (10611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276465 TGTTAGGTAGTTATGAGTAAA pLKO_005 2406 3UTR 100% 13.200 18.480 N PDLIM5 n/a
2 TRCN0000029741 CGCCCATTGTAACCAGGTCAT pLKO.1 1528 CDS 100% 4.050 5.670 N PDLIM5 n/a
3 TRCN0000285553 CGCCCATTGTAACCAGGTCAT pLKO_005 1528 CDS 100% 4.050 5.670 N PDLIM5 n/a
4 TRCN0000029739 CCCAGAATAAGATTAAGGGTT pLKO.1 378 CDS 100% 2.640 2.112 N PDLIM5 n/a
5 TRCN0000276402 CCTACTGTGAGACTGATTATT pLKO_005 1839 CDS 100% 15.000 10.500 N PDLIM5 n/a
6 TRCN0000276400 AGAATCTGAAGCCGATAATAC pLKO_005 760 CDS 100% 13.200 9.240 N PDLIM5 n/a
7 TRCN0000276401 TGCCCTCTTTGGTACTATATG pLKO_005 1861 CDS 100% 13.200 9.240 N PDLIM5 n/a
8 TRCN0000029740 CTGTGTAAGAAACATGCTCAT pLKO.1 2024 CDS 100% 4.050 2.835 N PDLIM5 n/a
9 TRCN0000029743 CCTGTATTGTGAGCTGTGCTA pLKO.1 1660 CDS 100% 2.640 1.848 N PDLIM5 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3289 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2599 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2600 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3286 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07648 pDONR223 100% 66.2% 65.9% None (many diffs) n/a
2 ccsbBroad304_07648 pLX_304 0% 66.2% 65.9% V5 (many diffs) n/a
3 TRCN0000480419 AGTGTAATCATCCGAGAGCCTTTT pLX_317 24.1% 66.2% 65.9% V5 (many diffs) n/a
4 ccsbBroadEn_07649 pDONR223 100% 31.7% 29.2% None (many diffs) n/a
5 ccsbBroad304_07649 pLX_304 0% 31.7% 29.2% V5 (many diffs) n/a
6 TRCN0000475444 CAAGGGATGGAAGCCACCAATCTA pLX_317 57.8% 31.7% 29.2% V5 (many diffs) n/a
Download CSV