Transcript: Human NM_001272042.1

Homo sapiens ribosomal protein S6 kinase B1 (RPS6KB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
RPS6KB1 (6198)
Length:
5299
CDS:
140..1648

Additional Resources:

NCBI RefSeq record:
NM_001272042.1
NBCI Gene record:
RPS6KB1 (6198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148368 AGCAGAACGGAATATTCTGG pXPR_003 AGG 370 25% 4 0.4204 RPS6KB1 RPS6KB1 75614
2 BRDN0001145927 AATGAAAGCATGGACCATGG pXPR_003 GGG 167 11% 2 0.2347 RPS6KB1 RPS6KB1 75613
3 BRDN0001145729 CTTCGGGTACTTGGTAAAGG pXPR_003 GGG 296 20% 3 0.1796 RPS6KB1 RPS6KB1 75612
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272042.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196342 GCATGTATGATACTCCATAAA pLKO.1 4623 3UTR 100% 13.200 18.480 N RPS6KB1 n/a
2 TRCN0000195109 CCGGAGAATATCATGCTTAAT pLKO.1 731 CDS 100% 13.200 7.920 N RPS6KB1 n/a
3 TRCN0000022904 GCATGGAACATTGTGAGAAAT pLKO.1 333 CDS 100% 13.200 7.920 N Rps6kb1 n/a
4 TRCN0000297869 GCATGGAACATTGTGAGAAAT pLKO_005 333 CDS 100% 13.200 7.920 N Rps6kb1 n/a
5 TRCN0000003162 GCATCGGCACCACTTCCAATA pLKO.1 1544 CDS 100% 10.800 6.480 N RPS6KB1 n/a
6 TRCN0000315004 GCGACATCTTCTCAACCTTAT pLKO_005 1886 3UTR 100% 10.800 6.480 N RPS6KB1 n/a
7 TRCN0000315003 ATCCGATCACCTCGAAGATTT pLKO_005 1364 CDS 100% 13.200 6.600 Y RPS6KB1 n/a
8 TRCN0000195341 CCAAGGTCATGTGAAACTAAC pLKO.1 754 CDS 100% 10.800 5.400 Y RPS6KB1 n/a
9 TRCN0000194766 CCTATAATACTTGCAACTAAG pLKO.1 2033 3UTR 100% 10.800 5.400 Y RPS6KB1 n/a
10 TRCN0000197241 GCAATCTGAAGAGGATGTAAG pLKO.1 1189 CDS 100% 10.800 5.400 Y RPS6KB1 n/a
11 TRCN0000022907 GCAGTTAGAAAGAGAGGGAAT pLKO.1 616 CDS 100% 4.050 2.025 Y Rps6kb1 n/a
12 TRCN0000280573 GCAGTTAGAAAGAGAGGGAAT pLKO_005 616 CDS 100% 4.050 2.025 Y Rps6kb1 n/a
13 TRCN0000003159 AGCACAGCAAATCCTCAGACA pLKO.1 1460 CDS 100% 2.640 1.320 Y RPS6KB1 n/a
14 TRCN0000315001 AGCACAGCAAATCCTCAGACA pLKO_005 1460 CDS 100% 2.640 1.320 Y RPS6KB1 n/a
15 TRCN0000003158 CCCATGATCTCCAAACGGCCA pLKO.1 1604 CDS 100% 0.180 0.090 Y RPS6KB1 n/a
16 TRCN0000314934 CCCATGATCTCCAAACGGCCA pLKO_005 1604 CDS 100% 0.180 0.090 Y RPS6KB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272042.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489919 CGAACCTTCGACTGCACGAATTCC pLX_317 24.5% 95.4% 95.4% V5 (not translated due to prior stop codon) 308_309ins69;1506_1507insTTG n/a
2 ccsbBroadEn_11109 pDONR223 100% 81.3% 80.7% None (many diffs) n/a
3 ccsbBroad304_11109 pLX_304 0% 81.3% 80.7% V5 (many diffs) n/a
4 TRCN0000479002 ATGGCACAGCTAGAATGACTTCCC pLX_317 27.7% 81.3% 80.7% V5 (many diffs) n/a
5 ccsbBroadEn_14833 pDONR223 0% 81.3% 80.7% None (many diffs) n/a
6 ccsbBroad304_14833 pLX_304 49.9% 81.3% 80.7% V5 (many diffs) n/a
7 TRCN0000481178 ACCACACGATGAGTAGACCGGCCA pLX_317 32.8% 81.3% 80.7% V5 (many diffs) n/a
Download CSV