Transcript: Mouse NM_001310480.1

Mus musculus protein kinase, AMP-activated, gamma 2 non-catalytic subunit (Prkag2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Prkag2 (108099)
Length:
2851
CDS:
399..1730

Additional Resources:

NCBI RefSeq record:
NM_001310480.1
NBCI Gene record:
Prkag2 (108099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078841 CTCACGATTACAGATTTCATA pLKO.1 972 CDS 100% 5.625 7.875 N Prkag2 n/a
2 TRCN0000078839 GCTCACGATTACAGATTTCAT pLKO.1 971 CDS 100% 5.625 7.875 N Prkag2 n/a
3 TRCN0000078842 CGATGCTGTATACTCGTTGAT pLKO.1 1133 CDS 100% 4.950 6.930 N Prkag2 n/a
4 TRCN0000078840 GCAGATAGCATTGTGGGTATT pLKO.1 1632 CDS 100% 10.800 8.640 N Prkag2 n/a
5 TRCN0000430309 ATGAGGTCACACAAGTGTTAT pLKO_005 813 CDS 100% 13.200 9.240 N PRKAG2 n/a
6 TRCN0000078838 GCTGCAATAGAAGAGAGTAAA pLKO.1 1806 3UTR 100% 13.200 9.240 N Prkag2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08289 pDONR223 100% 74.5% 75.5% None (many diffs) n/a
2 ccsbBroad304_08289 pLX_304 0% 74.5% 75.5% V5 (many diffs) n/a
3 TRCN0000470612 ACTCCGAGAATTGCACTTTTTGAA pLX_317 25.2% 74.5% 75.5% V5 (many diffs) n/a
4 ccsbBroadEn_15066 pDONR223 0% 74.5% 75.5% None (many diffs) n/a
5 ccsbBroad304_15066 pLX_304 0% 74.5% 75.5% V5 (many diffs) n/a
6 TRCN0000470682 AAGCATTACAACATGTAGGTAAAT pLX_317 27.2% 74.5% 75.5% V5 (many diffs) n/a
7 TRCN0000488555 GGCGAATAATCCAGTCCTGCTCTC pLX_317 20.9% 68.8% 69.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_03303 pDONR223 100% 67.7% 72.7% None (many diffs) n/a
9 ccsbBroad304_03303 pLX_304 0% 67.7% 72.7% V5 (many diffs) n/a
10 TRCN0000473870 TCGCCAAGCTGGTAATCACGGCAG pLX_317 44.3% 67.7% 72.7% V5 (many diffs) n/a
Download CSV