Transcript: Mouse NM_001312914.1

Mus musculus kinase suppressor of ras 2 (Ksr2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ksr2 (333050)
Length:
6124
CDS:
828..3683

Additional Resources:

NCBI RefSeq record:
NM_001312914.1
NBCI Gene record:
Ksr2 (333050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363383 GATCGCGCAAGAGATTGTAAA pLKO_005 3125 CDS 100% 13.200 18.480 N Ksr2 n/a
2 TRCN0000363381 ACGCAGAGACCTTGGCAATTC pLKO_005 2039 CDS 100% 10.800 15.120 N Ksr2 n/a
3 TRCN0000022630 CTGTCCACACTGAAGCCAATT pLKO.1 1972 CDS 100% 10.800 15.120 N Gm1390 n/a
4 TRCN0000022594 CCGTTTGAACAGCTAGAGATT pLKO.1 2814 CDS 100% 4.950 6.930 N Ksr2 n/a
5 TRCN0000363377 GCAAGTTAAAGTGCCACAATA pLKO_005 2152 CDS 100% 13.200 10.560 N Ksr2 n/a
6 TRCN0000022650 CTACAAATACAAGCAACAGTT pLKO.1 2528 CDS 100% 4.950 3.960 N Gm1389 n/a
7 TRCN0000022597 CTCCAAACAAGATTGGATCAT pLKO.1 1310 CDS 100% 0.495 0.396 N Ksr2 n/a
8 TRCN0000378606 CCATCCGGTTGATTGACATAG pLKO_005 2899 CDS 100% 10.800 7.560 N Ksr2 n/a
9 TRCN0000022631 CAAACCCTTGAACCTCAAGAT pLKO.1 1832 CDS 100% 4.950 3.465 N Gm1390 n/a
10 TRCN0000022596 GAGAACGAAGAGAGCCACAAT pLKO.1 2679 CDS 100% 4.950 3.465 N Ksr2 n/a
11 TRCN0000022595 GCCATCCGGTTGATTGACATA pLKO.1 2898 CDS 100% 4.950 3.465 N Ksr2 n/a
12 TRCN0000022598 GCAAGAGATTGTAAAGGGCAT pLKO.1 3131 CDS 100% 2.160 1.512 N Ksr2 n/a
13 TRCN0000022652 CCACGCAGAGACCTTGGCAAT pLKO.1 2037 CDS 100% 1.350 0.810 N Gm1389 n/a
14 TRCN0000194721 CCATTACTTCAAATTGAAGTG pLKO.1 2646 CDS 100% 0.405 0.243 N KSR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13499 pDONR223 100% 77.5% 83.9% None (many diffs) n/a
2 ccsbBroad304_13499 pLX_304 0% 77.5% 83.9% V5 (many diffs) n/a
3 TRCN0000475094 TCTTCTCCGAATTGTACACATATC pLX_317 14.9% 77.5% 83.9% V5 (many diffs) n/a
4 ccsbBroadEn_15297 pDONR223 56.8% 77.4% 20.2% None (many diffs) n/a
5 ccsbBroad304_15297 pLX_304 0% 77.4% 20.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000469219 CAGATTCATAAGAGAGCCTCTTCA pLX_317 12.4% 77.4% 20.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV