Transcript: Human NM_001317817.1

Homo sapiens solute carrier family 10 member 7 (SLC10A7), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SLC10A7 (84068)
Length:
1684
CDS:
255..512

Additional Resources:

NCBI RefSeq record:
NM_001317817.1
NBCI Gene record:
SLC10A7 (84068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317817.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147553 GAGGCAGCTGCAATATTTAAT pLKO.1 511 CDS 100% 15.000 10.500 N SLC10A7 n/a
2 TRCN0000149893 GAAATGAGGCAGCTGCAATAT pLKO.1 506 CDS 100% 13.200 9.240 N SLC10A7 n/a
3 TRCN0000157440 GACTGGTTCATGGTCGGAATA pLKO.1 282 CDS 100% 10.800 7.560 N SLC10A7 n/a
4 TRCN0000150111 CTGAAGCCAGAAATAACTGTA pLKO.1 360 CDS 100% 4.950 3.465 N SLC10A7 n/a
5 TRCN0000149358 GACCACTGAAGCCAGAAATAA pLKO.1 355 CDS 100% 15.000 9.000 N SLC10A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317817.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12772 pDONR223 100% 73.7% 71.7% None (many diffs) n/a
2 ccsbBroad304_12772 pLX_304 0% 73.7% 71.7% V5 (many diffs) n/a
3 TRCN0000481615 TGCCGATCACAAAGCTGGCGATTC pLX_317 100% 73.7% 71.7% V5 (many diffs) n/a
4 ccsbBroadEn_16026 pDONR223 0% 53.4% 42.1% None 182_183ins137;255_256ins85 n/a
5 ccsbBroad304_16026 pLX_304 0% 53.4% 42.1% V5 182_183ins137;255_256ins85 n/a
6 ccsbBroadEn_12773 pDONR223 100% 45.6% 36% None 182_183ins137;255_256ins166 n/a
7 ccsbBroad304_12773 pLX_304 0% 45.6% 36% V5 182_183ins137;255_256ins166 n/a
8 TRCN0000471611 CAGCATACGTATGAGAGAGACTTT pLX_317 72.9% 45.6% 36% V5 182_183ins137;255_256ins166 n/a
Download CSV