Transcript: Human NM_001320654.1

Homo sapiens fibroblast growth factor receptor 2 (FGFR2), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
FGFR2 (2263)
Length:
4038
CDS:
716..2497

Additional Resources:

NCBI RefSeq record:
NM_001320654.1
NBCI Gene record:
FGFR2 (2263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148071 GCCGGCAAATGCCTCCACAG pXPR_003 TGG 118 7% 6 0.5371 FGFR2 FGFR2 76182
2 BRDN0001147365 GATAGCCATTTACTGCATAG pXPR_003 GGG 463 26% 8 0.5268 FGFR2 FGFR2 76183
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196699 GTTCTCTATATTCGGAATGTA pLKO.1 1007 CDS 100% 5.625 7.875 N FGFR2 n/a
2 TRCN0000000368 CCGAATGAAGAACACGACCAA pLKO.1 1225 CDS 100% 2.640 3.696 N FGFR2 n/a
3 TRCN0000194817 CGTTGTTCCTTCTGTACTAAA pLKO.1 3801 3UTR 100% 13.200 10.560 N FGFR2 n/a
4 TRCN0000218493 AGCCCTGTTTGATAGAGTATA pLKO_005 2050 CDS 100% 13.200 9.240 N FGFR2 n/a
5 TRCN0000231053 ATATGGATCAGAGGAGTAAAT pLKO_005 2598 3UTR 100% 13.200 9.240 N FGFR2 n/a
6 TRCN0000321949 ATATGGATCAGAGGAGTAAAT pLKO_005 2598 3UTR 100% 13.200 9.240 N Fgfr2 n/a
7 TRCN0000000370 GCCAACCTCTCGAACAGTATT pLKO.1 2349 CDS 100% 13.200 9.240 N FGFR2 n/a
8 TRCN0000219680 TGGAGTACTCCTATGACATTA pLKO.1 1782 CDS 100% 13.200 9.240 N FGFR2 n/a
9 TRCN0000257217 TGGAGTACTCCTATGACATTA pLKO_005 1782 CDS 100% 13.200 9.240 N FGFR2 n/a
10 TRCN0000321950 TGGAGTACTCCTATGACATTA pLKO_005 1782 CDS 100% 13.200 9.240 N Fgfr2 n/a
11 TRCN0000000366 GCACACACTTACAGAGCACAA pLKO.1 2841 3UTR 100% 4.050 2.835 N FGFR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06211 pDONR223 100% 82.5% 80.2% None (many diffs) n/a
2 ccsbBroad304_06211 pLX_304 0% 82.5% 80.2% V5 (many diffs) n/a
3 TRCN0000491520 TTTCTTCGCCTCATCTCCCTTGTC pLX_317 7.9% 71% 69.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000492076 ACTGTTTAAGGCTAGTTTATGATC pLX_317 16.5% 70.9% 69% V5 (many diffs) n/a
5 TRCN0000491431 CTCACCCCTTCATGGGAGAACTCG pLX_317 12.9% 68.5% 64.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14640 pDONR223 0% 68.3% 66.2% None (many diffs) n/a
7 ccsbBroad304_14640 pLX_304 0% 68.3% 66.2% V5 (many diffs) n/a
8 TRCN0000465402 CTAGCGAGATACATAGTTCGCTAC pLX_317 9.6% 68.3% 66.2% V5 (many diffs) n/a
9 TRCN0000488178 TTTGGGGCAGTGGTGCCCTACGGC pLX_317 9.8% 68.3% 66.2% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000489718 CGCCACTACCTCAGAATTGCTGAT pLX_317 16.4% 68.2% 66.1% V5 (many diffs) n/a
11 TRCN0000487708 AAGTTCAAGTCTTTTTGTAGGCCG pLX_317 15.7% 64.7% 64.7% V5 (not translated due to prior stop codon) 1_627del n/a
Download CSV