Transcript: Human NM_001320709.2

Homo sapiens protein kinase N2 (PKN2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PKN2 (5586)
Length:
6022
CDS:
309..3215

Additional Resources:

NCBI RefSeq record:
NM_001320709.2
NBCI Gene record:
PKN2 (5586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147750 GGGATGCGTACATCAACCAC pXPR_003 TGG 1590 55% 11 0.8699 PKN2 PKN2 77926
2 BRDN0001487065 TTTGAAGCTCGATAATACTG pXPR_003 TGG 1156 40% 8 0.2249 PKN2 PKN2 77928
3 BRDN0001149537 TTGTTGCTAGTAGAACAACG pXPR_003 AGG 390 13% 3 -0.0434 PKN2 PKN2 77927
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380770 TGATATCAAGGATCGAATTAA pLKO_005 446 CDS 100% 15.000 21.000 N PKN2 n/a
2 TRCN0000194752 CAATCATGTAACAGGCTTATA pLKO.1 3836 3UTR 100% 13.200 18.480 N PKN2 n/a
3 TRCN0000353006 CAATCATGTAACAGGCTTATA pLKO_005 3836 3UTR 100% 13.200 18.480 N PKN2 n/a
4 TRCN0000379782 GGCCTAGAATATAGTGGTATT pLKO_005 2154 CDS 100% 10.800 15.120 N PKN2 n/a
5 TRCN0000377251 TTACCTCAGAAGCACCTATTC pLKO_005 3109 CDS 100% 10.800 15.120 N PKN2 n/a
6 TRCN0000195219 CTTAGCATGTTAGGGTCATTA pLKO.1 4671 3UTR 100% 13.200 10.560 N PKN2 n/a
7 TRCN0000219649 GTCCACGTCAAAGTATGATAT pLKO.1 1225 CDS 100% 13.200 10.560 N PKN2 n/a
8 TRCN0000332969 GTCCACGTCAAAGTATGATAT pLKO_005 1225 CDS 100% 13.200 10.560 N PKN2 n/a
9 TRCN0000422087 ATTGTACTTCAGCGTAAATAT pLKO_005 3395 3UTR 100% 15.000 10.500 N PKN2 n/a
10 TRCN0000006254 GCAGCAGAAATTGGATGATAT pLKO.1 431 CDS 100% 13.200 9.240 N PKN2 n/a
11 TRCN0000006251 GCAGGAATTAAATGCACATAT pLKO.1 608 CDS 100% 13.200 9.240 N PKN2 n/a
12 TRCN0000196735 GCAGGGTCTATTTACACAATT pLKO.1 5269 3UTR 100% 13.200 9.240 N PKN2 n/a
13 TRCN0000219650 TACTTTGGAAGTTCGTCTTAT pLKO.1 1295 CDS 100% 13.200 9.240 N PKN2 n/a
14 TRCN0000332970 TACTTTGGAAGTTCGTCTTAT pLKO_005 1295 CDS 100% 13.200 9.240 N PKN2 n/a
15 TRCN0000012716 CCAAGGTTCTTATCTACAGAA pLKO.1 2889 CDS 100% 4.950 3.465 N Pkn2 n/a
16 TRCN0000006252 CCACCATTTATACCTACCATA pLKO.1 3051 CDS 100% 4.950 3.465 N PKN2 n/a
17 TRCN0000006253 GCACATTCATACTGATGTCTT pLKO.1 2501 CDS 100% 4.950 3.465 N PKN2 n/a
18 TRCN0000006250 GCCACCAATAGCTTCTGAGTT pLKO.1 3292 3UTR 100% 4.950 3.465 N PKN2 n/a
19 TRCN0000084683 CCCAAGATCCTTTGGGAGAAA pLKO.1 4941 3UTR 100% 0.495 0.347 N Zfp646 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489928 AAGTCCCACCATTGCGCAATTGCA pLX_317 14.6% 98.3% 98.3% V5 (not translated due to prior stop codon) 1122_1123ins48 n/a
2 ccsbBroadEn_15539 pDONR223 0% 93.3% 93.3% None (many diffs) n/a
3 ccsbBroad304_15539 pLX_304 0% 93.3% 93.3% V5 (many diffs) n/a
4 ccsbBroadEn_15538 pDONR223 0% 6.1% 6.1% None 1_2724del n/a
5 ccsbBroad304_15538 pLX_304 0% 6.1% 6.1% V5 1_2724del n/a
6 TRCN0000468463 GCACGTAACCATTAAAGTGCCTCT pLX_317 100% 6.1% 6.1% V5 1_2724del n/a
Download CSV