Transcript: Human NM_001322238.2

Homo sapiens ribosomal protein S6 kinase A5 (RPS6KA5), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
RPS6KA5 (9252)
Length:
26335
CDS:
371..2122

Additional Resources:

NCBI RefSeq record:
NM_001322238.2
NBCI Gene record:
RPS6KA5 (9252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322238.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001498 CGCGGTGGAAATCATGAAGAA pLKO.1 1612 CDS 100% 4.950 6.930 N RPS6KA5 n/a
2 TRCN0000195329 CCGGATATTCTAGGATCTTCC pLKO.1 1814 CDS 100% 4.050 5.670 N RPS6KA5 n/a
3 TRCN0000001496 GCAGATTTATGTTGGAGAGAT pLKO.1 175 5UTR 100% 4.950 3.960 N RPS6KA5 n/a
4 TRCN0000001494 ACCTATGACTTGTTTGGAAAT pLKO.1 3183 3UTR 100% 10.800 7.560 N RPS6KA5 n/a
5 TRCN0000196479 GAAGCTTGTTTCAGCTGTAAG pLKO.1 1291 CDS 100% 10.800 7.560 N RPS6KA5 n/a
6 TRCN0000196345 GTGCACTGTTTAAAGCATTTG pLKO.1 2913 3UTR 100% 10.800 7.560 N RPS6KA5 n/a
7 TRCN0000196766 GTTTGGGTGTTCTAATGTATG pLKO.1 432 CDS 100% 10.800 7.560 N RPS6KA5 n/a
8 TRCN0000001495 GCACCATTTAAGCCAGTCATT pLKO.1 710 CDS 100% 4.950 3.465 N RPS6KA5 n/a
9 TRCN0000379468 AGCAACCTTCCACGCCTTTAA pLKO_005 1861 CDS 100% 13.200 7.920 N RPS6KA5 n/a
10 TRCN0000434454 AGACCAACCTGGGCAACATAG pLKO_005 4951 3UTR 100% 10.800 5.400 Y SULT1A1 n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 21261 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 14273 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
13 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 14273 3UTR 100% 4.950 2.475 Y SPC25 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 13023 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 14124 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
16 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 22933 3UTR 100% 4.050 2.025 Y INTS7 n/a
17 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 21240 3UTR 100% 4.050 2.025 Y LOC441087 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 13024 3UTR 100% 13.200 6.600 Y LIAS n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12536 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 14124 3UTR 100% 4.950 2.475 Y OR11A1 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 12536 3UTR 100% 5.625 2.813 Y EID2B n/a
22 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 9943 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322238.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02123 pDONR223 100% 41.1% 41% None 0_1ins657;988_991delAATTinsG;994_1749del n/a
2 ccsbBroad304_02123 pLX_304 0% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
3 TRCN0000466446 TCTTTACTTTACGTCATCATTACA pLX_317 26.9% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
4 ccsbBroadEn_14934 pDONR223 0% 41.1% 41% None 0_1ins657;988_991delAATTinsG;994_1749del n/a
5 ccsbBroad304_14934 pLX_304 0% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
6 TRCN0000480681 TACACAATAACACTCCCGACAATC pLX_317 26.9% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
Download CSV