Transcript: Human NM_001353261.2

Homo sapiens family with sequence similarity 49 member B (FAM49B), transcript variant 23, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FAM49B (51571)
Length:
3950
CDS:
427..1401

Additional Resources:

NCBI RefSeq record:
NM_001353261.2
NBCI Gene record:
FAM49B (51571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172477 CCACGAAATACGAGAGGCAAT pLKO.1 606 CDS 100% 4.050 5.670 N FAM49B n/a
2 TRCN0000167497 GCAGCTAATTATGCATTGCAT pLKO.1 1629 3UTR 100% 3.000 4.200 N FAM49B n/a
3 TRCN0000264755 GCCATCTAAGGCAGCTAATTA pLKO_005 1619 3UTR 100% 15.000 12.000 N Fam49b n/a
4 TRCN0000418224 ATCAGGTGAATGTAGTATTAA pLKO_005 536 CDS 100% 15.000 10.500 N FAM49B n/a
5 TRCN0000425112 GAATGATTTCAGCTATTATAG pLKO_005 885 CDS 100% 13.200 9.240 N FAM49B n/a
6 TRCN0000264756 TAATGGTGGGTGTCATAATAC pLKO_005 1193 CDS 100% 13.200 9.240 N Fam49b n/a
7 TRCN0000432309 TTGAGTCGTATGAGGATTAAC pLKO_005 913 CDS 100% 13.200 9.240 N FAM49B n/a
8 TRCN0000264758 ATTGATATGAAAGGTTGTATC pLKO_005 1261 CDS 100% 10.800 7.560 N Fam49b n/a
9 TRCN0000420983 ATTGATATGAAAGGTTGTATC pLKO_005 1261 CDS 100% 10.800 7.560 N FAM49B n/a
10 TRCN0000168777 GTCATTCTGCTTGAGGGTAAT pLKO.1 1176 CDS 100% 10.800 7.560 N FAM49B n/a
11 TRCN0000167814 GCAAATCGAATGTCTTTGTTT pLKO.1 976 CDS 100% 5.625 3.938 N FAM49B n/a
12 TRCN0000172968 GCAGGCTCTTGCTAAACAGTT pLKO.1 801 CDS 100% 4.950 3.465 N FAM49B n/a
13 TRCN0000168446 GCAATGACTGAGAATGCAGTT pLKO.1 1446 3UTR 100% 4.050 2.835 N FAM49B n/a
14 TRCN0000172577 GATGAGACTACCTCCAAGCAA pLKO.1 1360 CDS 100% 3.000 2.100 N FAM49B n/a
15 TRCN0000430901 ACTGCCTATTCTGCTATTTAA pLKO_005 1752 3UTR 100% 15.000 9.000 N FAM49B n/a
16 TRCN0000264754 CCGGAATACAGAAGCAGATTT pLKO_005 1138 CDS 100% 13.200 7.920 N Fam49b n/a
17 TRCN0000168778 GCTGTAGACAGAAGACAGTAT pLKO.1 1422 3UTR 100% 4.950 2.970 N FAM49B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03336 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03336 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471959 TCGTCTAGCGGCAGCCCGTTTCCC pLX_317 38.5% 100% 100% V5 n/a
4 ccsbBroadEn_08323 pDONR223 100% 99.8% 99.6% None 507C>A n/a
5 ccsbBroad304_08323 pLX_304 0% 99.8% 99.6% V5 507C>A n/a
6 TRCN0000472493 CGATGCATGTAAAACTTTATGGAA pLX_317 47% 99.8% 99.6% V5 507C>A n/a
Download CSV