Transcript: Human NM_001362770.2

Homo sapiens casein kinase 2 alpha 1 (CSNK2A1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CSNK2A1 (1457)
Length:
3007
CDS:
346..1521

Additional Resources:

NCBI RefSeq record:
NM_001362770.2
NBCI Gene record:
CSNK2A1 (1457)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222204 GCCAATATGATGTCAGGGATT pLKO.1 1390 CDS 100% 4.050 2.430 N Csnk2a1 n/a
2 TRCN0000027627 GCCATCAACATCACAAATAAT pLKO.1 511 CDS 100% 15.000 7.500 Y LOC245355 n/a
3 TRCN0000382268 GCACAGAAAGCTACGACTAAT pLKO_005 846 CDS 100% 13.200 6.600 Y CSNK2A1 n/a
4 TRCN0000222208 CAACACAGACTTCAAGCAATT pLKO.1 696 CDS 100% 10.800 5.400 Y Csnk2a1 n/a
5 TRCN0000361111 GCAATTGTACCAGACGTTAAC pLKO_005 711 CDS 100% 10.800 5.400 Y Csnk2a1 n/a
6 TRCN0000380839 TGGACAAACTGCTGCGATATG pLKO_005 1247 CDS 100% 10.800 5.400 Y CSNK2A1 n/a
7 TRCN0000195296 CGATTATAGTTTGGATATGTG pLKO.1 972 CDS 100% 4.950 2.475 Y CSNK2A1 n/a
8 TRCN0000000607 CGTAAACAACACAGACTTCAA pLKO.1 690 CDS 100% 4.950 2.475 Y CSNK2A1 n/a
9 TRCN0000010673 CGTAAACAACACAGACTTCAA pLKO.1 690 CDS 100% 4.950 2.475 Y CSNK2A1 n/a
10 TRCN0000320926 CGTAAACAACACAGACTTCAA pLKO_005 690 CDS 100% 4.950 2.475 Y CSNK2A1 n/a
11 TRCN0000000608 CAAGAATATAATGTCCGAGTT pLKO.1 901 CDS 100% 4.050 2.025 Y CSNK2A1 n/a
12 TRCN0000001985 CAAGAATATAATGTCCGAGTT pLKO.1 901 CDS 100% 4.050 2.025 Y CSNK2A1 n/a
13 TRCN0000000610 CCAAGAATATAATGTCCGAGT pLKO.1 900 CDS 100% 2.160 1.080 Y CSNK2A1 n/a
14 TRCN0000001987 CCAAGAATATAATGTCCGAGT pLKO.1 900 CDS 100% 2.160 1.080 Y CSNK2A1 n/a
15 TRCN0000000609 AGAATTTGAGAGGAGGTCCCA pLKO.1 602 CDS 100% 0.660 0.330 Y CSNK2A1 n/a
16 TRCN0000010672 AGAATTTGAGAGGAGGTCCCA pLKO.1 602 CDS 100% 0.660 0.330 Y CSNK2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00381 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00381 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481421 CCAGCAGAGCACTACACAGTGGCT pLX_317 38.4% 100% 100% V5 n/a
4 ccsbBroadEn_14604 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14604 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000475347 TATACTCCTGATCCTGCACCAGTC pLX_317 45% 100% 100% V5 n/a
7 TRCN0000489332 CTTAAACCGTTGGGACCTTGAGCT pLX_317 30.6% 100% 100% V5 (not translated due to prior stop codon) n/a
8 TRCN0000491260 AAACCCATAGATCGAGCTTCCTTG pLX_317 25.2% 100% 100% V5 (not translated due to prior stop codon) n/a
9 TRCN0000489503 CGTCCTCGAGGCTAAGACATGATA pLX_317 37.1% 99.9% 99.7% V5 1173_1174insG n/a
Download CSV