Transcript: Human NM_001365552.1

Homo sapiens NIMA related kinase 5 (NEK5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
NEK5 (341676)
Length:
5971
CDS:
136..2634

Additional Resources:

NCBI RefSeq record:
NM_001365552.1
NBCI Gene record:
NEK5 (341676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148037 TGGAGCTCACGAGAAAACCC pXPR_003 CGG 681 27% 10 1.1746 NEK5 NEK5 76120
2 BRDN0001146851 TCTTAGCAAGAACGGAATGG pXPR_003 TGG 421 17% 7 0.7015 NEK5 NEK5 76117
3 BRDN0001148329 AAAAGGATCAATAGACAACG pXPR_003 GGG 284 11% 5 0.6183 NEK5 NEK5 76119
4 BRDN0001144996 ACAATATTACCATTGACTTG pXPR_003 GGG 1201 48% 13 0.1183 NEK5 NEK5 76118
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082545 GTAGAAATGGTCTCTGGCATT pLKO.1 2296 CDS 100% 4.050 5.670 N LOC387927 n/a
2 TRCN0000358267 ACAGATTTCTCTAGGACTAAA pLKO_005 465 CDS 100% 13.200 9.240 N NEK5 n/a
3 TRCN0000196614 GCATGAAGTTTAAGGAATATG pLKO.1 1898 CDS 100% 13.200 9.240 N NEK5 n/a
4 TRCN0000358266 CCTTCGGGAAAGCATACTTAG pLKO_005 176 CDS 100% 10.800 7.560 N NEK5 n/a
5 TRCN0000021411 GCCCACCAAGATCAAGGATAT pLKO.1 1064 CDS 100% 10.800 7.560 N NEK5 n/a
6 TRCN0000021412 CCAACAGTACCACAATGACAT pLKO.1 1557 CDS 100% 4.950 3.465 N NEK5 n/a
7 TRCN0000082544 CCAAGATCTGATGATGATGAT pLKO.1 2341 CDS 100% 4.950 3.465 N LOC387927 n/a
8 TRCN0000082543 CCAGTACCTCTAAGGACTCTA pLKO.1 2462 CDS 100% 4.950 3.465 N LOC387927 n/a
9 TRCN0000021413 GTAATGGAGAAGAGCCTAGAT pLKO.1 1466 CDS 100% 4.950 3.465 N NEK5 n/a
10 TRCN0000082547 TCTGAAGATGAGTTGAGAGAT pLKO.1 2377 CDS 100% 4.950 3.465 N LOC387927 n/a
11 TRCN0000082546 CTGCCGATGAAGAATTTGCAA pLKO.1 2228 CDS 100% 3.000 2.100 N LOC387927 n/a
12 TRCN0000021410 GCCTTCTTCAATTCATTTCAA pLKO.1 328 CDS 100% 5.625 3.375 N NEK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15307 pDONR223 79.8% 80.6% 30.6% None (many diffs) n/a
2 ccsbBroad304_15307 pLX_304 0% 80.6% 30.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473796 AACCCCACCAACCTATGGAACTGT pLX_317 20.5% 80.6% 30.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10033 pDONR223 100% 78.8% 77.1% None (many diffs) n/a
5 ccsbBroad304_10033 pLX_304 0% 78.8% 77.1% V5 (many diffs) n/a
6 TRCN0000479295 TGCCTTTTGATCCACTCGCCGGAC pLX_317 16.5% 78.8% 77.1% V5 (many diffs) n/a
Download CSV