Transcript: Human NM_001367841.1

Homo sapiens immunoglobulin like and fibronectin type III domain containing 1 (IGFN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
IGFN1 (91156)
Length:
4440
CDS:
132..3887

Additional Resources:

NCBI RefSeq record:
NM_001367841.1
NBCI Gene record:
IGFN1 (91156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163188 GCTCCAAGCTAAGTCACTCAA pLKO.1 4092 3UTR 100% 4.950 6.930 N IGFN1 n/a
2 TRCN0000161407 GAGTTCCACATCCAGATACAA pLKO.1 1433 CDS 100% 5.625 3.938 N IGFN1 n/a
3 TRCN0000163405 GCCACCCTCATTGTCATAGAA pLKO.1 3855 CDS 100% 5.625 3.938 N IGFN1 n/a
4 TRCN0000162923 GAAGCCGGTGATAGTGAAGAT pLKO.1 1820 CDS 100% 4.950 3.465 N IGFN1 n/a
5 TRCN0000159798 GATGGAGTCATCTTTAAGCAA pLKO.1 1626 CDS 100% 3.000 2.100 N IGFN1 n/a
6 TRCN0000163160 GCAAGTCATAGACAAGCCTGA pLKO.1 2045 CDS 100% 2.160 1.512 N IGFN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12956 pDONR223 100% 68.1% 67.6% None (many diffs) n/a
2 ccsbBroad304_12956 pLX_304 0% 68.1% 67.6% V5 (many diffs) n/a
3 TRCN0000478870 TAAAAATTTCCGGTACATCCCCCA pLX_317 10.8% 68.1% 67.6% V5 (many diffs) n/a
4 ccsbBroadEn_15209 pDONR223 62.4% 62.5% 14.9% None (many diffs) n/a
5 ccsbBroad304_15209 pLX_304 0% 62.5% 14.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV