Transcript: Human NM_001654.5

Homo sapiens A-Raf proto-oncogene, serine/threonine kinase (ARAF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ARAF (369)
Length:
2378
CDS:
107..1927

Additional Resources:

NCBI RefSeq record:
NM_001654.5
NBCI Gene record:
ARAF (369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001654.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369090 GCCGTGACCAGATTATCTTTA pLKO_005 1647 CDS 100% 13.200 18.480 N ARAF n/a
2 TRCN0000380490 GGTTGTGCTCTACGAGCTTAT pLKO_005 1594 CDS 100% 10.800 15.120 N ARAF n/a
3 TRCN0000315030 GTCCACTCCCAACGTCCATAT pLKO_005 745 CDS 100% 10.800 15.120 N ARAF n/a
4 TRCN0000000567 CCAGCCAATCAATGTTCGTCT pLKO.1 1987 3UTR 100% 2.640 3.696 N ARAF n/a
5 TRCN0000315099 CCAGCCAATCAATGTTCGTCT pLKO_005 1987 3UTR 100% 2.640 3.696 N ARAF n/a
6 TRCN0000199244 CCCTGTCTCCTCCATCATTTG pLKO.1 2120 3UTR 100% 10.800 7.560 N ARAF n/a
7 TRCN0000000571 GACTCATCAAGGGACGAAAGA pLKO.1 294 CDS 100% 4.950 3.465 N ARAF n/a
8 TRCN0000315027 GACTCATCAAGGGACGAAAGA pLKO_005 294 CDS 100% 4.950 3.465 N ARAF n/a
9 TRCN0000000569 GTCTAACAACATCTTCCTACA pLKO.1 1399 CDS 100% 4.050 2.835 N ARAF n/a
10 TRCN0000000570 TCTTGCTGTTTATGGGCTTCA pLKO.1 1203 CDS 100% 4.050 2.835 N ARAF n/a
11 TRCN0000000568 GTAGAGGAGGTAGTGATGGAA pLKO.1 843 CDS 100% 3.000 2.100 N ARAF n/a
12 TRCN0000199116 CCAACAGTTCTACCACAGTGT pLKO.1 559 CDS 100% 2.640 1.848 N ARAF n/a
13 TRCN0000199992 CCTCCATCATTTGGTTTCCTC pLKO.1 2128 3UTR 100% 2.640 1.848 N ARAF n/a
14 TRCN0000199465 GCAGCTGAGGTGATCCGTATG pLKO.1 1526 CDS 100% 2.000 1.400 N ARAF n/a
15 TRCN0000315028 GCAGCTGAGGTGATCCGTATG pLKO_005 1526 CDS 100% 2.000 1.400 N ARAF n/a
16 TRCN0000199981 GCACTGATGCTGCCGGTAGTA pLKO.1 825 CDS 100% 1.650 1.155 N ARAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001654.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15358 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15358 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466363 CCTGGGTTTACAGATGTGGCTTAC pLX_317 12.9% 100% 100% V5 n/a
4 ccsbBroadEn_14544 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14544 pLX_304 34.2% 100% 100% V5 n/a
6 TRCN0000466438 TTAATCGCAATTCTTCAACCCGCT pLX_317 18.8% 100% 100% V5 n/a
7 TRCN0000487716 TACTCTTTCGACAGCCAACCCGGG pLX_317 13% 100% 100% V5 (not translated due to prior stop codon) n/a
8 ccsbBroadEn_13813 pDONR223 100% 99.4% 99.3% None 458_459insGCCCTCAAG;1808G>N n/a
9 ccsbBroad304_13813 pLX_304 0% 99.4% 99.3% V5 458_459insGCCCTCAAG;1808G>N n/a
10 TRCN0000481643 GATAACGTGACCGCTAGGGGTCCA pLX_317 17.9% 99.4% 99% V5 (not translated due to frame shift) 458_459insGCCCTCAAG;1808delG n/a
Download CSV