Transcript: Human NM_006994.5

Homo sapiens butyrophilin subfamily 3 member A3 (BTN3A3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
BTN3A3 (10384)
Length:
2970
CDS:
212..1966

Additional Resources:

NCBI RefSeq record:
NM_006994.5
NBCI Gene record:
BTN3A3 (10384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006994.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428672 GCTGCAGGGTAGAGATCATTT pLKO_005 2406 3UTR 100% 13.200 18.480 N BTN3A3 n/a
2 TRCN0000123206 GAGAAGTCTTTGGCCTATCAT pLKO.1 1181 CDS 100% 5.625 4.500 N BTN3A3 n/a
3 TRCN0000419383 CCCTGTCGGGTAGTCATATTT pLKO_005 2206 3UTR 100% 15.000 10.500 N BTN3A3 n/a
4 TRCN0000421774 GCCTTAGTCCCTGGCTAATTG pLKO_005 2309 3UTR 100% 13.200 9.240 N BTN3A3 n/a
5 TRCN0000123205 GCAACAACCAATCAGAACCAT pLKO.1 1913 CDS 100% 3.000 2.100 N BTN3A3 n/a
6 TRCN0000123207 CGCTGCAACAGAGCAAGAAAT pLKO.1 1096 CDS 100% 13.200 7.920 N BTN3A3 n/a
7 TRCN0000123208 CACATTGAAGTGAAGGGTTAT pLKO.1 662 CDS 100% 10.800 6.480 N BTN3A3 n/a
8 TRCN0000418427 CAAACCTGCGGATGTGATTCT pLKO_005 1222 CDS 100% 4.950 2.970 N BTN3A3 n/a
9 TRCN0000123204 CCCTAGAGATTCTCTGTGATA pLKO.1 2696 3UTR 100% 4.950 2.475 Y BTN3A3 n/a
10 TRCN0000162141 CCCTAGAGATTCTCTGTGATA pLKO.1 2696 3UTR 100% 4.950 2.475 Y BTN3A1 n/a
11 TRCN0000061426 GAACGTGTATGCAGATGGAAA pLKO.1 439 CDS 100% 4.950 2.475 Y BTN3A2 n/a
12 TRCN0000161171 GCCTTCCTTCAATCAAGGTTT pLKO.1 2659 3UTR 100% 4.950 2.475 Y BTN3A1 n/a
13 TRCN0000061427 GCCAGTTACTTCTTGTGGAGA pLKO.1 1007 CDS 100% 2.640 1.320 Y BTN3A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006994.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02417 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02417 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468589 ACTAGCCCAGTTCCAATTTATGAG pLX_317 22.1% 100% 100% V5 n/a
4 TRCN0000489137 TTACTCAGCCTTAGGATTTATCGA pLX_317 21.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489559 ACATCAGTGTCGACACGCCAGATT pLX_317 21.9% 99.9% 99.8% V5 1752_1753insG n/a
6 TRCN0000489719 CATACACTGCGTGGTTCGTCGGTA pLX_317 25.4% 79.3% 74.8% V5 (many diffs) n/a
7 TRCN0000489565 GTACGATGCCCACACCGAACAAGC pLX_317 22.8% 79.3% 74.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_07755 pDONR223 100% 79.2% 74.6% None (many diffs) n/a
9 ccsbBroad304_07755 pLX_304 0% 79.2% 74.6% V5 (many diffs) n/a
10 ccsbBroadEn_10209 pDONR223 100% 54% 51.7% None (many diffs) n/a
11 ccsbBroad304_10209 pLX_304 0% 54% 51.7% V5 (many diffs) n/a
12 TRCN0000480174 CACTCTCACGGGGATCCTTCGGCT pLX_317 36.8% 54% 51.7% V5 (many diffs) n/a
Download CSV