Construct: ORF TRCN0000492319
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011440.1_s317c1
- Derived from:
- ccsbBroadEn_02664
- DNA Barcode:
- TCACCATTCCTGCGTCCACGACGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDX19B (11269)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492319
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001014449.3 | 100% | 100% | |
2 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257173.2 | 100% | 100% | |
3 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257174.2 | 100% | 100% | |
4 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320525.1 | 91.8% | 94% | (many diffs) |
5 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257175.2 | 88.6% | 88.6% | 0_1ins126 |
6 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320526.1 | 86.3% | 87.5% | (many diffs) |
7 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001014451.3 | 81.6% | 78.2% | (many diffs) |
8 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001257172.2 | 80.7% | 77.4% | (many diffs) |
9 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320522.1 | 77.3% | 77.5% | (many diffs) |
10 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_007242.7 | 77.2% | 77.2% | 1_327del |
11 | human | 11269 | DDX19B | DEAD-box helicase 19B | NM_001363938.1 | 76.4% | 76.4% | 1_342del |
12 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_001320527.1 | 75.3% | 73.8% | (many diffs) |
13 | human | 55308 | DDX19A | DEAD-box helicase 19A | NM_018332.5 | 74.5% | 76.3% | (many diffs) |
14 | human | 55308 | DDX19A | DEAD-box helicase 19A | NR_135296.1 | 34.5% | (many diffs) | |
15 | human | 55308 | DDX19A | DEAD-box helicase 19A | XR_002957830.1 | 27.1% | (many diffs) | |
16 | mouse | 13680 | Ddx19a | DEAD (Asp-Glu-Ala-Asp) box ... | XM_006530650.3 | 85.3% | 92.7% | (many diffs) |
17 | mouse | 234733 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_172284.5 | 69.9% | 75.5% | (many diffs) |
18 | mouse | 13680 | Ddx19a | DEAD (Asp-Glu-Ala-Asp) box ... | NM_007916.2 | 69.3% | 75.3% | (many diffs) |
19 | mouse | 234733 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_001190786.1 | 67.8% | 73.2% | (many diffs) |
20 | mouse | 234733 | Ddx19b | DEAD (Asp-Glu-Ala-Asp) box ... | NM_001190800.1 | 67.5% | 71.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1176
- ORF length:
- 1110
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tttcaatcgt ccatccaaga tacaagagaa cgcattgcca ctgatgcttg 121 ctgagccccc acagaactta attgcccaat ctcagtctgg tactggtaaa acagctgcct 181 tcgtgctggc catgcttagc caagtagaac ctgcaaacaa atacccccag tgtctatgtc 241 tctccccaac gtatgagctc gccctccaaa caggaaaagt gattgaacaa atgggcaaat 301 tttaccctga actgaagcta gcttatgctg ttcgaggcaa taaattggaa agaggccaga 361 agatcagtga gcagattgtc attggcaccc ctgggactgt gctggactgg tgctccaagc 421 tcaagttcat tgatcccaag aaaatcaagg tgtttgttct ggatgaggct gatgtcatga 481 tagccactca gggccaccaa gatcagagca tccgcatcca gaggatgctg cccaggaact 541 gccagatgct gcttttctcc gccacctttg aagactctgt gtggaagttt gcccagaaag 601 tggtcccaga cccaaacgtt atcaaactga agcgtgagga agagaccctg gacaccatca 661 agcagtacta tgtcctgtgc agcagcagag acgagaagtt ccaggccttg tgtaacctct 721 acggggccat caccattgct caagccatga tcttctgcca tactcgcaaa acagctagtt 781 ggctggcagc agagctctca aaagaaggcc accaggtggc tctgctgagt ggggagatga 841 tggtggaaca gagggctgca gtgattgagc gcttccgaga gggcaaagag aaggttttgg 901 tgaccaccaa cgtgtgtgcc cgcggcattg atgttgaaca agtgtctgtc gtcatcaact 961 ttgatcttcc cgtggacaag gacgggaatc ctgacaatga gacctacctg caccggatcg 1021 ggcgcacggg ccgctttggc aagaggggcc tggcagtgaa catggtggac agcaagcaca 1081 gcatgaacat cctgaacaga atccaggagc attttaataa gaagatagaa agattggaca 1141 cagatgattt ggacGAGATT GAGAAAATAG CCAACTGCCC AACTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 ATCACCATTC CTGCGTCCAC GACGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt