Transcript: Human NM_007297.4

Homo sapiens BRCA1 DNA repair associated (BRCA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
BRCA1 (672)
Length:
7028
CDS:
195..5645

Additional Resources:

NCBI RefSeq record:
NM_007297.4
NBCI Gene record:
BRCA1 (672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007297.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244988 GCTATGCAAGGGTCCCTTAAA pLKO_005 5798 3UTR 100% 13.200 18.480 N BRCA1 n/a
2 TRCN0000221590 CCCTTCTAAATGCCCATCATT pLKO.1 4544 CDS 100% 5.625 7.875 N BRCA1 n/a
3 TRCN0000010305 GAGAATCCTAGAGATACTGAA pLKO.1 1137 CDS 100% 4.950 6.930 N BRCA1 n/a
4 TRCN0000221591 GCCTACAAGAAAGTACGAGAT pLKO.1 268 CDS 100% 4.050 5.670 N BRCA1 n/a
5 TRCN0000009823 TATAAGACCTCTGGCATGAAT pLKO.1 6705 3UTR 100% 5.625 4.500 N BRCA1 n/a
6 TRCN0000244987 ACTGATACTGCTGGGTATAAT pLKO_005 4911 CDS 100% 15.000 10.500 N BRCA1 n/a
7 TRCN0000244985 CAATATGGAACTCGAATTAAA pLKO_005 1829 CDS 100% 15.000 10.500 N BRCA1 n/a
8 TRCN0000244984 GAGTATGCAAACAGCTATAAT pLKO_005 351 CDS 100% 15.000 10.500 N BRCA1 n/a
9 TRCN0000244986 TTGCAACCTGAGGTCTATAAA pLKO_005 3318 CDS 100% 15.000 10.500 N BRCA1 n/a
10 TRCN0000221587 CCCTAAGTTTACTTCTCTAAA pLKO.1 6029 3UTR 100% 13.200 9.240 N BRCA1 n/a
11 TRCN0000221588 GCCCACCTAATTGTACTGAAT pLKO.1 1948 CDS 100% 4.950 3.465 N BRCA1 n/a
12 TRCN0000009824 TATAGCTGTTGGAAGGACTAG pLKO.1 6894 3UTR 100% 4.050 2.835 N BRCA1 n/a
13 TRCN0000221589 CCCACCTAATTGTACTGAATT pLKO.1 1949 CDS 100% 0.000 0.000 N BRCA1 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6239 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6240 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007297.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10699 pDONR223 100% 72.3% 72.1% None (many diffs) n/a
2 ccsbBroad304_10699 pLX_304 0% 72.3% 72.1% V5 (many diffs) n/a
3 TRCN0000470790 CGAGAAGCCCGACGCTAGTATCCC pLX_317 10.9% 72.3% 72.1% V5 (many diffs) n/a
4 ccsbBroadEn_00173 pDONR223 100% 34.9% 33.5% None (many diffs) n/a
5 ccsbBroad304_00173 pLX_304 30.7% 34.9% 33.5% V5 (many diffs) n/a
6 TRCN0000472103 TGTGCGGCCGCCACCACGTGCGCA pLX_317 23.8% 34.9% 33.5% V5 (many diffs) n/a
Download CSV