Transcript: Mouse NM_007938.2

Mus musculus Eph receptor A6 (Epha6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Epha6 (13840)
Length:
4213
CDS:
284..3676

Additional Resources:

NCBI RefSeq record:
NM_007938.2
NBCI Gene record:
Epha6 (13840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145443 GAAAACATATCCATTAAATG pXPR_003 GGG 445 13% 2 -0.2384 Epha6 EPHA6 76248
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360619 CATCACTGCAGAACGATAAAT pLKO_005 3903 3UTR 100% 15.000 21.000 N Epha6 n/a
2 TRCN0000023393 GCGTCAGGCATGAAGTATCTT pLKO.1 2912 CDS 100% 5.625 7.875 N Epha6 n/a
3 TRCN0000023390 CGGCCAGTAATGATCGTAGTA pLKO.1 2798 CDS 100% 4.950 6.930 N Epha6 n/a
4 TRCN0000023389 CCAGGATTCTACAAAGCATTT pLKO.1 1406 CDS 100% 10.800 8.640 N Epha6 n/a
5 TRCN0000360620 ACGAATGAGCATCGATGATAT pLKO_005 3547 CDS 100% 13.200 9.240 N Epha6 n/a
6 TRCN0000021415 CCCAAGCCATTCACAGCTATT pLKO.1 1847 CDS 100% 10.800 7.560 N EPHA6 n/a
7 TRCN0000194829 CCAAACATCATTCGCCTAGAA pLKO.1 2633 CDS 100% 4.950 3.465 N EPHA6 n/a
8 TRCN0000023391 GCAGCATACAAACTTTACGTT pLKO.1 3615 CDS 100% 3.000 2.100 N Epha6 n/a
9 TRCN0000360688 TCCCTAGCAGTCCACGAATTT pLKO_005 2411 CDS 100% 13.200 7.920 N Epha6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15300 pDONR223 0% 89.7% 95% None (many diffs) n/a
2 ccsbBroad304_15300 pLX_304 0% 89.7% 95% V5 (many diffs) n/a
3 TRCN0000489808 GCGAATCGTGCGTGGGCGGTAGCG pLX_317 35% 25.9% 26.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489560 TTCAAGTCGTGCGGGCTTGCCTCT pLX_317 32.2% 25.2% 26.3% V5 (many diffs) n/a
Download CSV