Transcript: Mouse NM_008314.2

Mus musculus 5-hydroxytryptamine (serotonin) receptor 5A (Htr5a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Htr5a (15563)
Length:
5576
CDS:
503..1576

Additional Resources:

NCBI RefSeq record:
NM_008314.2
NBCI Gene record:
Htr5a (15563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026281 CGAGCCTTCCTACACCGTGTT pLKO.1 1090 CDS 100% 1.350 1.890 N Htr5a n/a
2 TRCN0000026298 GCGTGTCTCCAATGTGATGAT pLKO.1 967 CDS 100% 4.950 3.960 N Htr5a n/a
3 TRCN0000426093 TTGTAGCTCAGTGGGTTATAT pLKO_005 1609 3UTR 100% 15.000 10.500 N Htr5a n/a
4 TRCN0000433532 CTCTGGCTCCACTGCTATTTG pLKO_005 1020 CDS 100% 13.200 9.240 N Htr5a n/a
5 TRCN0000026280 CCTGTGGTTGGGCTATTCTAA pLKO.1 1471 CDS 100% 5.625 3.938 N Htr5a n/a
6 TRCN0000026324 CCCACTCATCTACACAGCATT pLKO.1 1504 CDS 100% 4.950 3.465 N Htr5a n/a
7 TRCN0000026292 GCATCTGGAATGTGACAGCAA pLKO.1 885 CDS 100% 2.640 1.848 N Htr5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00806 pDONR223 100% 84.4% 87.9% None (many diffs) n/a
2 ccsbBroad304_00806 pLX_304 0% 84.4% 87.9% V5 (many diffs) n/a
3 TRCN0000480496 GAATTAACCATGATCGGTTTGGTT pLX_317 32.2% 84.4% 87.9% V5 (many diffs) n/a
4 TRCN0000489686 AAGACGGACTACGCCATATATGAT pLX_317 40.2% 84.3% 87.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489886 GGACTAAGTCGTAGTTTTATGTAA pLX_317 41.1% 84.2% 87.7% V5 (many diffs) n/a
6 ccsbBroadEn_06419 pDONR223 100% 84.2% 87.6% None (many diffs) n/a
7 ccsbBroad304_06419 pLX_304 0% 84.2% 87.6% V5 (many diffs) n/a
8 TRCN0000475616 CTCTACGGTGATGGTACCTGATTG pLX_317 25.6% 84.2% 87.6% V5 (many diffs) n/a
Download CSV