Transcript: Mouse NM_008826.4

Mus musculus phosphofructokinase, liver, B-type (Pfkl), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pfkl (18641)
Length:
3741
CDS:
114..2456

Additional Resources:

NCBI RefSeq record:
NM_008826.4
NBCI Gene record:
Pfkl (18641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008826.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360433 CTACGTGATGTCTACCGTAAA pLKO_005 2181 CDS 100% 10.800 15.120 N Pfkl n/a
2 TRCN0000012541 GCTCAGCGTTTCCAATATCAT pLKO.1 323 CDS 100% 5.625 7.875 N Pfkl n/a
3 TRCN0000199670 GCTCCATCGATAACGACTTCT pLKO.1 601 CDS 100% 4.950 6.930 N PFKL n/a
4 TRCN0000342394 GCTCCATCGATAACGACTTCT pLKO_005 601 CDS 100% 4.950 6.930 N PFKL n/a
5 TRCN0000360434 GTGACCCGTATGGGCATATAT pLKO_005 222 CDS 100% 15.000 12.000 N Pfkl n/a
6 TRCN0000360432 ACCGCATTATGGAGGTCATTG pLKO_005 661 CDS 100% 10.800 7.560 N Pfkl n/a
7 TRCN0000360435 CTTACCCAAGGCTATAGTTTG pLKO_005 2828 3UTR 100% 10.800 7.560 N Pfkl n/a
8 TRCN0000012539 CCGGTCACAGAACTCAAGAAA pLKO.1 2274 CDS 100% 5.625 3.938 N Pfkl n/a
9 TRCN0000012542 GCTGCAATGGAGAGTTGTGAT pLKO.1 1752 CDS 100% 4.950 3.465 N Pfkl n/a
10 TRCN0000012540 CCTGAGTAGCAAGATGGGTAT pLKO.1 1046 CDS 100% 4.050 2.835 N Pfkl n/a
11 TRCN0000012538 GCAAACCTTACCCAAGGCTAT pLKO.1 2822 3UTR 100% 4.050 2.835 N Pfkl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008826.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491856 GGTCGCCCTAATCCGCAGAATTAT pLX_317 14.4% 87.1% 94.1% V5 (many diffs) n/a
2 ccsbBroadEn_15524 pDONR223 0% 87.1% 94.2% None (many diffs) n/a
3 ccsbBroad304_15524 pLX_304 0% 87.1% 94.2% V5 (many diffs) n/a
4 TRCN0000481270 CGAAACCAGAAGAAAAAACATGAC pLX_317 22.6% 87.1% 94.2% V5 (many diffs) n/a
5 TRCN0000489124 TAATCGTGGCGACGGTAACATTCG pLX_317 15% 87.1% 94.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15523 pDONR223 0% 87% 94.1% None (many diffs) n/a
7 ccsbBroad304_15523 pLX_304 0% 87% 94.1% V5 (many diffs) n/a
8 ccsbBroadEn_10491 pDONR223 100% 81.5% 85.8% None (many diffs) n/a
9 ccsbBroad304_10491 pLX_304 0% 81.5% 85.8% V5 (many diffs) n/a
10 TRCN0000473690 GAGTCTTACCTCTAACTGGCGGCC pLX_317 14.7% 81.5% 85.8% V5 (many diffs) n/a
11 ccsbBroadEn_14745 pDONR223 0% 81.5% 85.8% None (many diffs) n/a
12 ccsbBroad304_14745 pLX_304 0% 81.5% 85.8% V5 (many diffs) n/a
13 TRCN0000480916 TCGCACACGGACTCGTTGGGCGAT pLX_317 18% 81.5% 85.8% V5 (many diffs) n/a
14 ccsbBroadEn_15525 pDONR223 0% 52.2% 55.5% None (many diffs) n/a
15 ccsbBroad304_15525 pLX_304 0% 52.2% 55.5% V5 (many diffs) n/a
Download CSV