Transcript: Mouse NM_009316.1

Mus musculus mitogen-activated protein kinase kinase kinase 7 (Map3k7), transcript variant B, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Map3k7 (26409)
Length:
5763
CDS:
157..1977

Additional Resources:

NCBI RefSeq record:
NM_009316.1
NBCI Gene record:
Map3k7 (26409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022563 GCGCCTGAAGTATTTGAAGGT pLKO.1 745 CDS 100% 2.640 3.696 N Map3k7 n/a
2 TRCN0000322141 GCGCCTGAAGTATTTGAAGGT pLKO_005 745 CDS 100% 2.640 3.696 N Map3k7 n/a
3 TRCN0000022560 CGCCCTTCAATGGAGGAAATT pLKO.1 976 CDS 100% 13.200 10.560 N Map3k7 n/a
4 TRCN0000322345 CGCCCTTCAATGGAGGAAATT pLKO_005 976 CDS 100% 13.200 10.560 N Map3k7 n/a
5 TRCN0000022561 CAGCCCTAGTGTCAGAATGAT pLKO.1 1530 CDS 100% 5.625 3.938 N Map3k7 n/a
6 TRCN0000022562 TCTGAGAGGAAGGCTTTCATT pLKO.1 361 CDS 100% 5.625 3.938 N Map3k7 n/a
7 TRCN0000322142 TCTGAGAGGAAGGCTTTCATT pLKO_005 361 CDS 100% 5.625 3.938 N Map3k7 n/a
8 TRCN0000022559 AGGCAAAGCAACAGAGTGAAT pLKO.1 1223 CDS 100% 4.950 3.465 N Map3k7 n/a
9 TRCN0000322277 AGGCAAAGCAACAGAGTGAAT pLKO_005 1223 CDS 100% 4.950 3.465 N Map3k7 n/a
10 TRCN0000322278 AGAGAAGACAAACCATTATAA pLKO_005 2024 3UTR 100% 15.000 9.000 N Map3k7 n/a
11 TRCN0000195532 CCATCCAAGACTTGACTGTAA pLKO.1 1472 CDS 100% 4.950 3.465 N MAP3K7 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5037 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14856 pDONR223 0% 87.8% 94.8% None (many diffs) n/a
2 ccsbBroad304_14856 pLX_304 39% 87.8% 94.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000473540 CTTAATAACGAGGATTAACAACGT pLX_317 27.1% 87.8% 94.8% V5 (not translated due to frame shift) (many diffs) n/a
4 TRCN0000488462 TTCAGTCTCGCGCTAGGCGCCATT pLX_317 18.3% 87.8% 94.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489475 TTACTCACCAATTCGGAAGAAGGT pLX_317 25.4% 74% 78.6% V5 (many diffs) n/a
6 TRCN0000488961 GTCGGACGCGGTCTCTGATGACCG pLX_317 24.6% 74% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV