Transcript: Human NM_014586.2

Homo sapiens hormonally up-regulated Neu-associated kinase (HUNK), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HUNK (30811)
Length:
7680
CDS:
656..2800

Additional Resources:

NCBI RefSeq record:
NM_014586.2
NBCI Gene record:
HUNK (30811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196439 GACTCTGAACTCAGGTTTATT pLKO.1 5198 3UTR 100% 15.000 10.500 N HUNK n/a
2 TRCN0000196737 GCCTGTTGGTTAGTGTATTTA pLKO.1 7115 3UTR 100% 15.000 10.500 N HUNK n/a
3 TRCN0000195335 CCATAGGTGTGAACATGTATG pLKO.1 1398 CDS 100% 10.800 7.560 N HUNK n/a
4 TRCN0000002270 CAGAAGATGGTAGACAAAGAA pLKO.1 1478 CDS 100% 5.625 3.938 N HUNK n/a
5 TRCN0000002271 CCTGTGTTCATCCTGTTGTTT pLKO.1 3676 3UTR 100% 5.625 3.938 N HUNK n/a
6 TRCN0000002267 AGGCTCGCTTATGACACAGAT pLKO.1 2059 CDS 100% 4.950 3.465 N HUNK n/a
7 TRCN0000195392 CCTGATGCACAAGATCTATGA pLKO.1 1096 CDS 100% 4.950 3.465 N HUNK n/a
8 TRCN0000199252 CCTGTGAACCTTGCCTTTGAC pLKO.1 2750 CDS 100% 4.950 3.465 N HUNK n/a
9 TRCN0000002268 CCCAATATCACTCAGCTCCTT pLKO.1 1016 CDS 100% 2.640 1.848 N HUNK n/a
10 TRCN0000002269 CTGTAATGTCACCTATCCCAA pLKO.1 1642 CDS 100% 2.640 1.848 N HUNK n/a
11 TRCN0000196527 GATAGAGAATTTGCTACTAGA pLKO.1 1219 CDS 100% 4.950 2.970 N HUNK n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4625 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4625 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4623 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4623 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4623 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5828 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487764 AGTAATCCAAATGCTTTATAAAAG pLX_317 11.6% 99.9% 100% V5 (not translated due to prior stop codon) 1413T>C;1548T>C n/a
2 TRCN0000489089 TAAAATGGTCTTGATCTTCCTAAC pLX_317 16.2% 99.8% 99.8% V5 1413T>C;1548T>C;2142_2143insG n/a
Download CSV