Transcript: Human NM_015488.5

Homo sapiens PNKD metallo-beta-lactamase domain containing (PNKD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PNKD (25953)
Length:
2987
CDS:
18..1175

Additional Resources:

NCBI RefSeq record:
NM_015488.5
NBCI Gene record:
PNKD (25953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015488.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422865 AGCTAACAAGGCTTCTCATAA pLKO_005 104 CDS 100% 13.200 18.480 N PNKD n/a
2 TRCN0000062754 CCGCCTCTTCAATGGAGTGAA pLKO.1 356 CDS 100% 4.950 6.930 N PNKD n/a
3 TRCN0000420737 TGTGGCCTGGTCATGAGTATG pLKO_005 877 CDS 100% 10.800 7.560 N PNKD n/a
4 TRCN0000421838 ATCATCCTTCTCATCGCTAAC pLKO_005 1239 3UTR 100% 6.000 4.200 N PNKD n/a
5 TRCN0000420541 CTCAAGTGTGATGCCTTACAA pLKO_005 1623 3UTR 100% 5.625 3.938 N PNKD n/a
6 TRCN0000062753 CCAGCCATATTCCCATGTGAT pLKO.1 2180 3UTR 100% 4.950 3.465 N PNKD n/a
7 TRCN0000062757 AGCTGGAATACATTCCCAGAA pLKO.1 193 CDS 100% 4.050 2.835 N PNKD n/a
8 TRCN0000062756 GAAGGATATGCACAAGAGCAA pLKO.1 1151 CDS 100% 2.640 1.848 N PNKD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015488.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07971 pDONR223 100% 99.7% 99.2% None 34G>A;98C>T;139C>T n/a
2 ccsbBroad304_07971 pLX_304 0% 99.7% 99.2% V5 34G>A;98C>T;139C>T n/a
3 TRCN0000475264 TTTCCAGAGACGCCTGCCATGAGC pLX_317 9% 99.7% 99.2% V5 34G>A;98C>T;139C>T n/a
4 ccsbBroadEn_02891 pDONR223 100% 85.9% 78.9% None (many diffs) n/a
5 ccsbBroad304_02891 pLX_304 0% 85.9% 78.9% V5 (many diffs) n/a
6 TRCN0000474944 TCAATTTTGAGAGTCTCCACTGTC pLX_317 47.6% 85.9% 78.9% V5 (many diffs) n/a
7 ccsbBroadEn_15778 pDONR223 0% 31.3% 21.1% None (many diffs) n/a
8 ccsbBroad304_15778 pLX_304 0% 31.3% 21.1% V5 (many diffs) n/a
9 TRCN0000468359 GTTTGGGACACTTAATAAGGCAGG pLX_317 84.3% 31.3% 21.1% V5 (many diffs) n/a
Download CSV