Transcript: Human NM_021015.4

Homo sapiens SSX family member 5 (SSX5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SSX5 (6758)
Length:
1416
CDS:
86..775

Additional Resources:

NCBI RefSeq record:
NM_021015.4
NBCI Gene record:
SSX5 (6758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152931 CCCACCTTTCATGCGTAATAA pLKO.1 409 CDS 100% 15.000 9.000 N SSX5 n/a
2 TRCN0000154141 CCTAGGGTTGGTTCTCAAATA pLKO.1 116 CDS 100% 13.200 7.920 N SSX5 n/a
3 TRCN0000152960 GAGAGAAAGCAACTGGTGATT pLKO.1 716 CDS 100% 4.950 2.970 N SSX5 n/a
4 TRCN0000151398 GCCAAATACTTCTCTGAGAAA pLKO.1 293 CDS 100% 4.950 2.970 N SSX5 n/a
5 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 280 CDS 100% 13.200 6.600 Y SSX9P n/a
6 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 279 CDS 100% 10.800 5.400 Y SSX3 n/a
7 TRCN0000115839 CCAGCAGAGGAAGGAAATGAT pLKO.1 554 CDS 100% 5.625 2.813 Y SSX7 n/a
8 TRCN0000157378 CCAGCAGAGGAAGGAAATGAT pLKO.1 554 CDS 100% 5.625 2.813 Y SSX5 n/a
9 TRCN0000157304 CGTGGGAATCAGGTTGAACAT pLKO.1 476 CDS 100% 4.950 2.475 Y SSX5 n/a
10 TRCN0000157537 GTGTGCCAAGAGTTCGATGTT pLKO.1 930 3UTR 100% 4.950 2.475 Y SSX5 n/a
11 TRCN0000021692 GCCTTCGATGATATTGCCAAA pLKO.1 278 CDS 100% 4.050 2.025 Y SSX2 n/a
12 TRCN0000153294 GAAGAGAAAGTATGAGGCCAT pLKO.1 361 CDS 100% 2.160 1.080 Y SSX5 n/a
13 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 887 3UTR 100% 0.495 0.248 Y SSX6P n/a
14 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 887 3UTR 100% 0.495 0.248 Y SSX5 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1232 3UTR 100% 4.950 2.475 Y KAAG1 n/a
16 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 799 3UTR 100% 4.950 2.475 Y SSX9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07002 pDONR223 100% 99.7% 99.5% None 55G>C;492G>A n/a
2 ccsbBroad304_07002 pLX_304 0% 99.7% 99.5% V5 55G>C;492G>A n/a
3 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 99.7% 99.5% V5 55G>C;492G>A n/a
4 ccsbBroadEn_02358 pDONR223 100% 76.5% 69.4% None (many diffs) n/a
5 ccsbBroad304_02358 pLX_304 0% 76.5% 69.4% V5 (many diffs) n/a
6 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 76.5% 69.4% V5 (many diffs) n/a
7 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 76.2% 68.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 76.1% 68.6% V5 (many diffs) n/a
9 ccsbBroadEn_07001 pDONR223 100% 76.1% 68.5% None (many diffs) n/a
10 ccsbBroad304_07001 pLX_304 0% 76.1% 68.5% V5 (many diffs) n/a
11 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 75.8% 68.1% V5 (many diffs) n/a
12 ccsbBroadEn_01604 pDONR223 100% 74.3% 63.3% None (many diffs) n/a
13 ccsbBroad304_01604 pLX_304 0% 74.3% 63.3% V5 (many diffs) n/a
14 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 74.3% 63.3% V5 (many diffs) n/a
15 ccsbBroadEn_07003 pDONR223 100% 73.6% 64.1% None (many diffs) n/a
16 ccsbBroad304_07003 pLX_304 0% 73.6% 64.1% V5 (many diffs) n/a
17 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 73.6% 64.1% V5 (many diffs) n/a
18 ccsbBroadEn_02357 pDONR223 100% 66.8% 54.5% None (many diffs) n/a
19 ccsbBroad304_02357 pLX_304 0% 66.8% 54.5% V5 (many diffs) n/a
20 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 66.8% 54.5% V5 (many diffs) n/a
21 ccsbBroadEn_01605 pDONR223 100% 58.2% 45.9% None (many diffs) n/a
22 ccsbBroad304_01605 pLX_304 0% 58.2% 45.9% V5 (many diffs) n/a
23 TRCN0000479927 TTAGGGCCACATCTTTCATTTATA pLX_317 56.6% 58.2% 45.9% V5 (many diffs) n/a
24 TRCN0000489622 TCTCTACATGTCCGATTTTAATCG pLX_317 50.9% 58.2% 45.8% V5 (many diffs) n/a
25 TRCN0000491259 ACCCAGTTTATTCAAGCATACCTT pLX_317 34.3% 58.2% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV