Transcript: Mouse NM_025423.2

Mus musculus RIKEN cDNA 1110059E24 gene (1110059E24Rik), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
1110059E24Rik (66206)
Length:
1428
CDS:
84..551

Additional Resources:

NCBI RefSeq record:
NM_025423.2
NBCI Gene record:
1110059E24Rik (66206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191632 GAGATCGTTATTCCGTTTAAT pLKO.1 393 CDS 100% 15.000 21.000 N 1110059E24Rik n/a
2 TRCN0000365383 AGTTCTTGAGTGGCGTGTAAA pLKO_005 233 CDS 100% 13.200 18.480 N C9orf85 n/a
3 TRCN0000376943 CCTCGGGTATGTGACTCATTA pLKO_005 830 3UTR 100% 13.200 18.480 N 1110059E24Rik n/a
4 TRCN0000366593 GTTCTTGAGTGGCGTGTAAAG pLKO_005 234 CDS 100% 10.800 15.120 N 1110059E24Rik n/a
5 TRCN0000191480 GCGTGTAAAGTACAGCAAATA pLKO.1 245 CDS 100% 13.200 10.560 N 1110059E24Rik n/a
6 TRCN0000216314 GTAACACTTAAGCTGTATATA pLKO.1 648 3UTR 100% 15.000 10.500 N 1110059E24Rik n/a
7 TRCN0000366529 CCTGACAACACCAAGTCAATT pLKO_005 547 CDS 100% 13.200 9.240 N 1110059E24Rik n/a
8 TRCN0000163695 GTGCCTGTGAACTTGAAGTTT pLKO.1 349 CDS 100% 5.625 3.938 N C9orf85 n/a
9 TRCN0000379292 ACTCTTACCACATAATGTGTA pLKO_005 322 CDS 100% 4.950 3.465 N 1110059E24Rik n/a
10 TRCN0000189911 GAAGTTCTTGAGTGGCGTGTA pLKO.1 231 CDS 100% 4.050 2.835 N 1110059E24Rik n/a
11 TRCN0000190999 CGTACAATCATGTGTAATGAT pLKO.1 911 3UTR 100% 0.563 0.394 N 1110059E24Rik n/a
12 TRCN0000366594 ACACTACACACACGTACAATC pLKO_005 899 3UTR 100% 10.800 6.480 N 1110059E24Rik n/a
13 TRCN0000166145 CTCAGAAGCACCAGAATACGT pLKO.1 121 CDS 100% 3.000 1.800 N C9orf85 n/a
14 TRCN0000377017 AGGTTCTGGCCATAGAAGACG pLKO_005 449 CDS 100% 2.640 1.584 N 1110059E24Rik n/a
15 TRCN0000202391 GCACCAGAATACGTTCACCTT pLKO.1 128 CDS 100% 2.640 1.584 N 1110059E24Rik n/a
16 TRCN0000376944 TCATGATGGAGTATGTCAGCG pLKO_005 203 CDS 100% 2.160 1.296 N 1110059E24Rik n/a
17 TRCN0000365380 AGAAGCACCAGAATACGTTTA pLKO_005 124 CDS 100% 10.800 6.480 N C9orf85 n/a
18 TRCN0000164047 CAGAAGCACCAGAATACGTTT pLKO.1 123 CDS 100% 4.950 2.970 N C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04917 pDONR223 100% 83.4% 81.5% None (many diffs) n/a
2 ccsbBroad304_04917 pLX_304 0% 83.4% 81.5% V5 (many diffs) n/a
3 TRCN0000481530 CGTATCAGCACGACACGCGAAGAC pLX_317 90.4% 83.4% 81.5% V5 (many diffs) n/a
4 ccsbBroadEn_16095 pDONR223 0% 20.2% 20.6% None (many diffs) n/a
5 ccsbBroad304_16095 pLX_304 0% 20.2% 20.6% V5 (many diffs) n/a
Download CSV