Transcript: Mouse NM_054089.4

Mus musculus trimethylguanosine synthase 1 (Tgs1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tgs1 (116940)
Length:
4389
CDS:
148..2709

Additional Resources:

NCBI RefSeq record:
NM_054089.4
NBCI Gene record:
Tgs1 (116940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090625 GAACAATTTCAGTATTGGGAA pLKO.1 889 CDS 100% 2.640 3.696 N Tgs1 n/a
2 TRCN0000090538 GCTCGGAATAATGCTGAAGTT pLKO.1 2305 CDS 100% 4.950 3.960 N Gm5117 n/a
3 TRCN0000090623 GCACTGTCTTTCCTTACAATA pLKO.1 4176 3UTR 100% 13.200 9.240 N Tgs1 n/a
4 TRCN0000338135 TGAAGTGGTTTGAGATCTTTA pLKO_005 2847 3UTR 100% 13.200 9.240 N Tgs1 n/a
5 TRCN0000338063 ATGCAAGAAATAAAGCTAAAG pLKO_005 485 CDS 100% 10.800 7.560 N Tgs1 n/a
6 TRCN0000338136 TCTGAAGCGGAAGTGTGATAC pLKO_005 2692 CDS 100% 10.800 7.560 N Tgs1 n/a
7 TRCN0000338133 CCTGTAATGGAACACCCAAAG pLKO_005 1223 CDS 100% 6.000 4.200 N Tgs1 n/a
8 TRCN0000090627 GCAGCCTGAAAGCAGATGTAA pLKO.1 995 CDS 100% 5.625 3.938 N Tgs1 n/a
9 TRCN0000090624 CCACCTGAAATAGCTTCTGTT pLKO.1 2026 CDS 100% 4.950 3.465 N Tgs1 n/a
10 TRCN0000090626 CCAGAGAACTGTTCAACTGAA pLKO.1 1918 CDS 100% 4.950 3.465 N Tgs1 n/a
11 TRCN0000090540 CGCTTTGATGATGGAATCAAA pLKO.1 2092 CDS 100% 0.563 0.394 N Gm5117 n/a
12 TRCN0000338134 ACACAGAAGTAGACCAGAATG pLKO_005 968 CDS 100% 10.800 6.480 N Tgs1 n/a
13 TRCN0000090539 CCTGGAGAAATGACTATGAAA pLKO.1 563 CDS 100% 5.625 4.500 N Gm5117 n/a
14 TRCN0000200422 GCCTTTACCTACTGAGCCATT pLKO.1 3475 3UTR 100% 4.050 2.025 Y Ap5z1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13010 pDONR223 100% 15% 15.7% None (many diffs) n/a
2 ccsbBroad304_13010 pLX_304 0% 15% 15.7% V5 (many diffs) n/a
3 TRCN0000470908 CCGTATATTTCTATTTATTTATCG pLX_317 93.9% 15% 15.7% V5 (many diffs) n/a
Download CSV