Transcript: Human NM_173358.2

Homo sapiens SSX family member 7 (SSX7), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
SSX7 (280658)
Length:
1340
CDS:
160..726

Additional Resources:

NCBI RefSeq record:
NM_173358.2
NBCI Gene record:
SSX7 (280658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422739 ACCAAGGGAATCAGGTTGAAC pLKO_005 425 CDS 100% 4.950 3.465 N SSX7 n/a
2 TRCN0000433847 ACCTAGGGCTGGTGCTCAAAT pLKO_005 189 CDS 100% 13.200 7.920 N SSX7 n/a
3 TRCN0000115838 CTCCCACCTTTCATGCATAAT pLKO.1 358 CDS 100% 13.200 7.920 N SSX7 n/a
4 TRCN0000115840 CCTCCCACCTTTCATGCATAA pLKO.1 357 CDS 100% 10.800 6.480 N SSX7 n/a
5 TRCN0000413679 GTGACAAGAGTTCGATGTTAG pLKO_005 883 3UTR 100% 10.800 6.480 N SSX7 n/a
6 TRCN0000115841 CCAAGTACCTCTGAGAAGATT pLKO.1 592 CDS 100% 5.625 3.375 N SSX7 n/a
7 TRCN0000115837 CCTACCTCAGAAAGCAAGTAT pLKO.1 1009 3UTR 100% 5.625 3.375 N SSX7 n/a
8 TRCN0000115723 CTTCGATGATATTGCCAAATA pLKO.1 231 CDS 100% 13.200 6.600 Y SSX9P n/a
9 TRCN0000020146 CCTTCGATGATATTGCCAAAT pLKO.1 230 CDS 100% 10.800 5.400 Y SSX3 n/a
10 TRCN0000413186 TGAGTGTTTAATTTCCGATTT pLKO_005 1100 3UTR 100% 10.800 5.400 Y SSX7 n/a
11 TRCN0000115839 CCAGCAGAGGAAGGAAATGAT pLKO.1 505 CDS 100% 5.625 2.813 Y SSX7 n/a
12 TRCN0000157378 CCAGCAGAGGAAGGAAATGAT pLKO.1 505 CDS 100% 5.625 2.813 Y SSX5 n/a
13 TRCN0000021760 GCCAAATACTTCTCTAAGAAA pLKO.1 244 CDS 100% 5.625 2.813 Y SSX4 n/a
14 TRCN0000115731 GCTATGTGTATATGAAGAGAA pLKO.1 299 CDS 100% 4.950 2.475 Y SSX8P n/a
15 TRCN0000020147 GCTGGTGATTTATGAAGAGAT pLKO.1 678 CDS 100% 4.950 2.475 Y SSX3 n/a
16 TRCN0000121776 CTGAGTGTTTAATTTCCGATT pLKO.1 1099 3UTR 100% 4.050 2.025 Y SSX6P n/a
17 TRCN0000153294 GAAGAGAAAGTATGAGGCCAT pLKO.1 312 CDS 100% 2.160 1.080 Y SSX5 n/a
18 TRCN0000021763 CCAGAGAATCTTCCCGAAGAT pLKO.1 471 CDS 100% 0.495 0.248 Y SSX4 n/a
19 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 838 3UTR 100% 0.495 0.248 Y SSX6P n/a
20 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 838 3UTR 100% 0.495 0.248 Y SSX5 n/a
21 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 750 3UTR 100% 4.950 2.475 Y SSX9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02358 pDONR223 100% 92.1% 85.1% None (many diffs) n/a
2 ccsbBroad304_02358 pLX_304 0% 92.1% 85.1% V5 (many diffs) n/a
3 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 92.1% 85.1% V5 (many diffs) n/a
4 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 92% 85.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 91.8% 85.1% V5 (many diffs) n/a
6 ccsbBroadEn_07001 pDONR223 100% 91.8% 85.1% None (many diffs) n/a
7 ccsbBroad304_07001 pLX_304 0% 91.8% 85.1% V5 (many diffs) n/a
8 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 91.4% 84.5% V5 (many diffs) n/a
9 ccsbBroadEn_07003 pDONR223 100% 90.6% 82.4% None (many diffs) n/a
10 ccsbBroad304_07003 pLX_304 0% 90.6% 82.4% V5 (many diffs) n/a
11 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 90.6% 82.4% V5 (many diffs) n/a
12 ccsbBroadEn_01604 pDONR223 100% 89.3% 79.2% None (many diffs) n/a
13 ccsbBroad304_01604 pLX_304 0% 89.3% 79.2% V5 (many diffs) n/a
14 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 89.3% 79.2% V5 (many diffs) n/a
15 ccsbBroadEn_02357 pDONR223 100% 80.8% 65.3% None (many diffs) n/a
16 ccsbBroad304_02357 pLX_304 0% 80.8% 65.3% V5 (many diffs) n/a
17 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 80.8% 65.3% V5 (many diffs) n/a
18 ccsbBroadEn_07002 pDONR223 100% 75.6% 67.6% None (many diffs) n/a
19 ccsbBroad304_07002 pLX_304 0% 75.6% 67.6% V5 (many diffs) n/a
20 TRCN0000470951 GTCCCTCCTCTCTTCTGCAACACA pLX_317 67.7% 75.6% 67.6% V5 (many diffs) n/a
21 ccsbBroadEn_01605 pDONR223 100% 67.7% 53.6% None (many diffs) n/a
22 ccsbBroad304_01605 pLX_304 0% 67.7% 53.6% V5 (many diffs) n/a
23 TRCN0000479927 TTAGGGCCACATCTTTCATTTATA pLX_317 56.6% 67.7% 53.6% V5 (many diffs) n/a
24 TRCN0000489622 TCTCTACATGTCCGATTTTAATCG pLX_317 50.9% 67.7% 53.4% V5 (many diffs) n/a
25 TRCN0000491259 ACCCAGTTTATTCAAGCATACCTT pLX_317 34.3% 67.7% 53.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV