Transcript: Mouse NM_177045.3

Mus musculus coiled-coil and C2 domain containing 1B (Cc2d1b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cc2d1b (319965)
Length:
3286
CDS:
136..2682

Additional Resources:

NCBI RefSeq record:
NM_177045.3
NBCI Gene record:
Cc2d1b (319965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243918 CCGTAACCGCTGCATAGTAAT pLKO_005 2901 3UTR 100% 13.200 18.480 N Cc2d1b n/a
2 TRCN0000201788 GATCGCATTGCCAAGCAATAT pLKO.1 1372 CDS 100% 13.200 18.480 N Cc2d1b n/a
3 TRCN0000243916 GATCGCATTGCCAAGCAATAT pLKO_005 1372 CDS 100% 13.200 18.480 N Cc2d1b n/a
4 TRCN0000243917 TCCCACTTACGAGTAGCTAAA pLKO_005 1798 CDS 100% 10.800 15.120 N Cc2d1b n/a
5 TRCN0000189818 GCAACTTTAGCAACTGCCCAA pLKO.1 1519 CDS 100% 2.160 3.024 N Cc2d1b n/a
6 TRCN0000243919 GATTCAGTGGCAGCAACTTTA pLKO_005 1507 CDS 100% 13.200 10.560 N Cc2d1b n/a
7 TRCN0000243915 CATTGCTCCCTTGCCTGATTC pLKO_005 930 CDS 100% 10.800 8.640 N Cc2d1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14427 pDONR223 100% 53% 52% None (many diffs) n/a
2 ccsbBroad304_14427 pLX_304 0% 53% 52% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471693 GACGGCAGGGCAGTCACCTAAGGA pLX_317 22.7% 53% 52% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13380 pDONR223 100% 16.7% 17.8% None (many diffs) n/a
5 ccsbBroad304_13380 pLX_304 0% 16.7% 17.8% V5 (many diffs) n/a
6 TRCN0000467342 ATAAAATCCCCCATTCACTACGTG pLX_317 88.2% 16.7% 17.8% V5 (many diffs) n/a
Download CSV