Transcript: Mouse NM_178900.4

Mus musculus protein kinase D2 (Prkd2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Prkd2 (101540)
Length:
3625
CDS:
560..3187

Additional Resources:

NCBI RefSeq record:
NM_178900.4
NBCI Gene record:
Prkd2 (101540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178900.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350724 GAAAGATGGGCGAGCGATATA pLKO_005 3024 CDS 100% 13.200 18.480 N Prkd2 n/a
2 TRCN0000024328 GTACGACAAGATCCTGCTCTT pLKO.1 826 CDS 100% 4.050 5.670 N Prkd2 n/a
3 TRCN0000322346 GTACGACAAGATCCTGCTCTT pLKO_005 826 CDS 100% 4.050 5.670 N Prkd2 n/a
4 TRCN0000199598 GCTCGCATCATCGGCGAGAAG pLKO.1 2657 CDS 100% 0.000 0.000 N PRKD2 n/a
5 TRCN0000322348 GAAACTGCTCAAGGGTCTATT pLKO_005 1408 CDS 100% 13.200 9.240 N Prkd2 n/a
6 TRCN0000322347 CCTCAACCTTGGAGCGATAAG pLKO_005 3337 3UTR 100% 10.800 7.560 N Prkd2 n/a
7 TRCN0000322281 CGGCCAATGTCACCTACTTTG pLKO_005 1974 CDS 100% 10.800 7.560 N Prkd2 n/a
8 TRCN0000024324 CCACACACCTTCCTTATACAT pLKO.1 1352 CDS 100% 5.625 3.938 N Prkd2 n/a
9 TRCN0000024325 CCAACAGATACTACAAGGAAA pLKO.1 1863 CDS 100% 4.950 3.465 N Prkd2 n/a
10 TRCN0000024327 GCAGTAAAGGTCATTGACAAA pLKO.1 2294 CDS 100% 4.950 3.465 N Prkd2 n/a
11 TRCN0000024326 CGACCTCATCAACAACCTGTT pLKO.1 2905 CDS 100% 4.050 2.835 N Prkd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178900.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489002 TGTACTAACTGGCCAATTCCGCAC pLX_317 15.1% 88.2% 95.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15028 pDONR223 59.1% 87.8% 28.6% None (many diffs) n/a
3 ccsbBroad304_15028 pLX_304 0% 87.8% 28.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000473412 CTACGTAAAGGCGACCATTCGTTG pLX_317 15% 87.8% 28.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489157 CTATACTAGACCGTTATTCTAATG pLX_317 21.4% 54% 57.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV