Transcript: Human NM_182505.5

Homo sapiens chromosome 9 open reading frame 85 (C9orf85), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C9orf85 (138241)
Length:
1185
CDS:
97..570

Additional Resources:

NCBI RefSeq record:
NM_182505.5
NBCI Gene record:
C9orf85 (138241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182505.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365383 AGTTCTTGAGTGGCGTGTAAA pLKO_005 246 CDS 100% 13.200 18.480 N C9orf85 n/a
2 TRCN0000159121 GACATTGTTATTCCGTTGAAT pLKO.1 406 CDS 100% 5.625 7.875 N C9orf85 n/a
3 TRCN0000163508 GCACCAGAATACGTTTAGCTT pLKO.1 141 CDS 100% 3.000 2.400 N C9orf85 n/a
4 TRCN0000370480 CACAGGAGGAGACCATCAAAT pLKO_005 543 CDS 100% 13.200 9.240 N C9orf85 n/a
5 TRCN0000365382 GGAGTATGTCAGCGCTGTAAA pLKO_005 223 CDS 100% 13.200 9.240 N C9orf85 n/a
6 TRCN0000365379 TGAAGGATTCTTATCACATAA pLKO_005 329 CDS 100% 13.200 9.240 N C9orf85 n/a
7 TRCN0000365380 AGAAGCACCAGAATACGTTTA pLKO_005 137 CDS 100% 10.800 7.560 N C9orf85 n/a
8 TRCN0000162870 GAAGCACCAGAATACGTTTAG pLKO.1 138 CDS 100% 10.800 7.560 N C9orf85 n/a
9 TRCN0000365307 TGAAATCCTAATGAGGAAATC pLKO_005 953 3UTR 100% 10.800 7.560 N C9orf85 n/a
10 TRCN0000159474 CAGAATACGTTTAGCTTCAAA pLKO.1 145 CDS 100% 5.625 3.938 N C9orf85 n/a
11 TRCN0000163695 GTGCCTGTGAACTTGAAGTTT pLKO.1 362 CDS 100% 5.625 3.938 N C9orf85 n/a
12 TRCN0000164047 CAGAAGCACCAGAATACGTTT pLKO.1 136 CDS 100% 4.950 3.465 N C9orf85 n/a
13 TRCN0000160431 CCGTTGAATAAAGAAACAGAA pLKO.1 418 CDS 100% 4.950 3.465 N C9orf85 n/a
14 TRCN0000189911 GAAGTTCTTGAGTGGCGTGTA pLKO.1 244 CDS 100% 4.050 2.835 N 1110059E24Rik n/a
15 TRCN0000166145 CTCAGAAGCACCAGAATACGT pLKO.1 134 CDS 100% 3.000 2.100 N C9orf85 n/a
16 TRCN0000376944 TCATGATGGAGTATGTCAGCG pLKO_005 216 CDS 100% 2.160 1.512 N 1110059E24Rik n/a
17 TRCN0000370482 GAAGAAAGTGATGATGATTTA pLKO_005 499 CDS 100% 13.200 7.920 N C9orf85 n/a
18 TRCN0000370481 AGCAAATACAAACCATTATCA pLKO_005 271 CDS 100% 5.625 3.375 N C9orf85 n/a
19 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 609 3UTR 100% 4.950 2.475 Y GJD4 n/a
20 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 609 3UTR 100% 4.950 2.475 Y C9orf85 n/a
21 TRCN0000366593 GTTCTTGAGTGGCGTGTAAAG pLKO_005 247 CDS 100% 10.800 15.120 N 1110059E24Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182505.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04917 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04917 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481530 CGTATCAGCACGACACGCGAAGAC pLX_317 90.4% 100% 100% V5 n/a
4 ccsbBroadEn_16095 pDONR223 0% 22% 21.6% None 103_110delAAAATTAA;113_471delinsT n/a
5 ccsbBroad304_16095 pLX_304 0% 22% 21.6% V5 103_110delAAAATTAA;113_471delinsT n/a
Download CSV