Transcript: Mouse NM_198021.2

Mus musculus SCY1-like 2 (S. cerevisiae) (Scyl2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Scyl2 (213326)
Length:
3431
CDS:
277..3069

Additional Resources:

NCBI RefSeq record:
NM_198021.2
NBCI Gene record:
Scyl2 (213326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028804 CCTCCCACTATGTCAAACTTT pLKO.1 2707 CDS 100% 5.625 7.875 N Scyl2 n/a
2 TRCN0000361986 GAGACCCGATGCAGATCAAAT pLKO_005 1218 CDS 100% 13.200 10.560 N Scyl2 n/a
3 TRCN0000028757 CGCTCCCATTAAACAGACTAA pLKO.1 2406 CDS 100% 4.950 3.960 N Scyl2 n/a
4 TRCN0000368825 TAATCAAGGGAGACCTATATT pLKO_005 1056 CDS 100% 15.000 10.500 N Scyl2 n/a
5 TRCN0000368858 TCCAGACATCAAGGATTATAA pLKO_005 699 CDS 100% 15.000 10.500 N Scyl2 n/a
6 TRCN0000007151 GCCCTCAGAAACCCAAAGTTA pLKO.1 2810 CDS 100% 5.625 3.938 N SCYL2 n/a
7 TRCN0000320789 GCCCTCAGAAACCCAAAGTTA pLKO_005 2810 CDS 100% 5.625 3.938 N SCYL2 n/a
8 TRCN0000028754 GCTGTTATGTACGCCGTGTTT pLKO.1 1036 CDS 100% 4.950 3.465 N Scyl2 n/a
9 TRCN0000028836 GCCATCATTGTGTCTTCCGAA pLKO.1 942 CDS 100% 2.640 1.848 N Scyl2 n/a
10 TRCN0000028828 GCAGATTGATAAGGTCTTTAA pLKO.1 2205 CDS 100% 13.200 7.920 N Scyl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198021.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03628 pDONR223 100% 88.7% 93% None (many diffs) n/a
2 ccsbBroad304_03628 pLX_304 0% 88.7% 93% V5 (many diffs) n/a
3 TRCN0000476215 ATAAGATACATTCAACATGCGTTG pLX_317 11.7% 88.7% 93% V5 (many diffs) n/a
4 TRCN0000488679 GCAGCCACATGCGCACTAATTAAT pLX_317 12.1% 88.7% 93% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489230 GTATATTTGCGGGGCGTTATACAT pLX_317 14.7% 88.7% 92.9% V5 (many diffs) n/a
6 ccsbBroadEn_15106 pDONR223 56.5% 88.6% 71.7% None (many diffs) n/a
7 ccsbBroad304_15106 pLX_304 0% 88.6% 71.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000475054 CACTTACGCCACCACTATGTATCA pLX_317 16.9% 88.6% 71.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV