Transcript: Human NR_001278.1

Homo sapiens cytochrome P450 family 2 subfamily B member 7, pseudogene (CYP2B7P), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
CYP2B7P (1556)
Length:
3000
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_001278.1
NBCI Gene record:
CYP2B7P (1556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_001278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064044 GCCTTCAATCCTGACCACTTT pLKO.1 1227 3UTR 100% 4.950 2.475 Y CYP2B6 n/a
2 TRCN0000064047 GCCTACTCAAATCCTTTCTGA pLKO.1 157 3UTR 100% 3.000 1.500 Y CYP2B6 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1945 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000173917 GCCAACATCATCTGCTCCATT pLKO.1 534 3UTR 100% 4.950 2.475 Y Cyp2b9 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1945 3UTR 100% 5.625 2.813 Y EID2B n/a
6 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 1899 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_001278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06074 pDONR223 100% 47.1% None (many diffs) n/a
2 ccsbBroad304_06074 pLX_304 0% 47.1% V5 (many diffs) n/a
3 TRCN0000477273 TACCCCATGCTGAATCCCTATTGT pLX_317 20.7% 47.1% V5 (many diffs) n/a
4 ccsbBroadEn_10223 pDONR223 100% 37.7% None 1_8delCTGGAACC;1140_3000del n/a
5 ccsbBroad304_10223 pLX_304 0% 37.7% V5 1_8delCTGGAACC;1140_3000del n/a
6 TRCN0000466850 AGGCGCTCCGGATATCTATCGGCC pLX_317 37.3% 37.7% V5 1_8delCTGGAACC;1140_3000del n/a
7 ccsbBroadEn_12783 pDONR223 100% 6.2% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 6.2% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 6.2% V5 (many diffs) n/a
10 ccsbBroadEn_11616 pDONR223 100% 5.7% None (many diffs) n/a
11 ccsbBroad304_11616 pLX_304 0% 5.7% V5 (many diffs) n/a
12 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 5.7% V5 (many diffs) n/a
Download CSV