Transcript: Human NR_001575.1

Homo sapiens ring finger protein 138 pseudogene 1 (RNF138P1), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
RNF138P1 (379013)
Length:
5701
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_001575.1
NBCI Gene record:
RNF138P1 (379013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_001575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1291 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
2 TRCN0000033834 CCCTGTGTCAAGAATCAAATT pLKO.1 4128 3UTR 100% 13.200 6.600 Y RNF138 n/a
3 TRCN0000289973 CCCTGTGTCAAGAATCAAATT pLKO_005 4128 3UTR 100% 13.200 6.600 Y RNF138 n/a
4 TRCN0000033836 CCTAGCCAGATTACCAGAAAT pLKO.1 4247 3UTR 100% 13.200 6.600 Y RNF138 n/a
5 TRCN0000289899 CCTAGCCAGATTACCAGAAAT pLKO_005 4247 3UTR 100% 13.200 6.600 Y RNF138 n/a
6 TRCN0000033838 GTCGTGGAAATGTGACTAGAA pLKO.1 3821 3UTR 100% 4.950 2.475 Y RNF138 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1396 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1396 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1824 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1824 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_001575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03309 pDONR223 100% 12.1% None (many diffs) n/a
2 ccsbBroad304_03309 pLX_304 0% 12.1% V5 (many diffs) n/a
3 TRCN0000471271 AACGGCGGTGCTAGGCGGGGCCCA pLX_317 53.5% 12.1% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 1.1% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 1.1% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.1% V5 (many diffs) n/a
Download CSV