Transcript: Human NR_002144.1

Homo sapiens mitogen-activated protein kinase kinase 2 pseudogene (LOC407835), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC407835 (407835)
Length:
1737
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002144.1
NBCI Gene record:
LOC407835 (407835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195037 CTTCCAGGAGTTTGTCAATAA pLKO.1 1267 3UTR 100% 13.200 6.600 Y MAP2K2 n/a
2 TRCN0000342312 CTTCCAGGAGTTTGTCAATAA pLKO_005 1267 3UTR 100% 13.200 6.600 Y MAP2K2 n/a
3 TRCN0000007005 CCAACATCCTCGTGAACTCTA pLKO.1 837 3UTR 100% 4.950 2.475 Y MAP2K2 n/a
4 TRCN0000195427 CGAACTCAAAGACGATGACTT pLKO.1 439 3UTR 100% 4.950 2.475 Y MAP2K2 n/a
5 TRCN0000342309 CGAACTCAAAGACGATGACTT pLKO_005 439 3UTR 100% 4.950 2.475 Y MAP2K2 n/a
6 TRCN0000011062 CAACATCCTCGTGAACTCTAG pLKO.1 838 3UTR 100% 4.050 2.025 Y MAP2K2 n/a
7 TRCN0000342311 CAACATCCTCGTGAACTCTAG pLKO_005 838 3UTR 100% 4.050 2.025 Y MAP2K2 n/a
8 TRCN0000055065 CCTCCGAGAGAAGCACCAGAT pLKO.1 793 3UTR 100% 1.350 0.675 Y Map2k2 n/a
9 TRCN0000288078 CCTCCGAGAGAAGCACCAGAT pLKO_005 793 3UTR 100% 1.350 0.675 Y Map2k2 n/a
10 TRCN0000199022 CCCTTCCAGCTGAGGACAGGC pLKO.1 1508 3UTR 100% 0.000 0.000 Y MAP2K2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14808 pDONR223 0% 65.9% None (many diffs) n/a
2 ccsbBroad304_14808 pLX_304 0% 65.9% V5 (many diffs) n/a
3 TRCN0000465915 AACCGTCGGGCCCACCATGAAATT pLX_317 17.9% 65.9% V5 (many diffs) n/a
4 TRCN0000487985 AGCCCTCCCGCTAGCATAACCTAG pLX_317 26.4% 65.9% V5 (many diffs) n/a
5 TRCN0000488054 AAGGTTTGCCGATAAATCTTAGCG pLX_317 23.1% 65.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000465689 TGACCGAAAAAAAATTTTTCGTTT pLX_317 17.9% 65.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10634 pDONR223 100% 65.5% None 1_247del;926G>A;1388_1737del n/a
8 ccsbBroad304_10634 pLX_304 0% 65.5% V5 1_247del;926G>A;1388_1737del n/a
9 TRCN0000477744 AAGCGGTCACCAGAATGAGGGTTC pLX_317 27.6% 65.5% V5 1_247del;926G>A;1388_1737del n/a
10 TRCN0000487698 GCGCTTTTCCTGCACCTTGACTTA pLX_317 23.3% 51% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV