Transcript: Human NR_003090.3

Homo sapiens myelin associated oligodendrocyte basic protein (MOBP), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MOBP (4336)
Length:
5717
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003090.3
NBCI Gene record:
MOBP (4336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064002 TCGGAAATACAGCATCTGTAA pLKO.1 272 3UTR 100% 4.950 6.930 N MOBP n/a
2 TRCN0000063999 CCAGAAGTACTCCGAACACTT pLKO.1 194 3UTR 100% 4.950 3.465 N MOBP n/a
3 TRCN0000064000 CGGCTGCTTCTACCAGAAGAA pLKO.1 296 3UTR 100% 4.950 3.465 N MOBP n/a
4 TRCN0000063998 CCTCAATTCCAAGAAGGAGAT pLKO.1 245 3UTR 100% 4.050 2.430 N MOBP n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3936 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3936 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01027 pDONR223 100% 4.2% None 1_149del;393_5717del n/a
2 ccsbBroad304_01027 pLX_304 0% 4.2% V5 1_149del;393_5717del n/a
3 TRCN0000467672 CTTTGCTCACATTTCAGAGTCAAA pLX_317 100% 4.2% V5 1_149del;393_5717del n/a
4 ccsbBroadEn_11616 pDONR223 100% 2.9% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 2.9% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 2.9% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% 1.1% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% 1.1% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.1% V5 (many diffs) n/a
Download CSV