Transcript: Human NR_004845.2

Homo sapiens actin beta pseudogene (LOC644936), non-coding RNA.

Source:
NCBI, updated 2018-08-23
Taxon:
Homo sapiens (human)
Gene:
LOC644936 (644936)
Length:
1394
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_004845.2
NBCI Gene record:
LOC644936 (644936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_004845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262863 TTGGCTTGACTCAGGATTTAA pLKO_005 911 3UTR 100% 15.000 7.500 Y POTEF n/a
2 TRCN0000029413 CGAAACTACCTTCAACTCCAT pLKO.1 498 3UTR 100% 2.640 1.320 Y ACTB n/a
3 TRCN0000349687 CGAAACTACCTTCAACTCCAT pLKO_005 498 3UTR 100% 2.640 1.320 Y ACTB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_004845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14514 pDONR223 100% 47% None 1_141del;789delC;799_1394del n/a
2 ccsbBroad304_14514 pLX_304 0% 47% V5 (not translated due to frame shift) 1_141del;789delC;799_1394del n/a
3 TRCN0000481436 GCTCGTTTACTAGTATTTTTAATC pLX_317 64.2% 47% V5 (not translated due to frame shift) 1_141del;789delC;799_1394del n/a
4 ccsbBroadEn_05763 pDONR223 100% 41.3% None (many diffs) n/a
5 ccsbBroad304_05763 pLX_304 53.1% 41.3% V5 (many diffs) n/a
6 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 41.3% V5 (many diffs) n/a
7 ccsbBroadEn_15351 pDONR223 0% 39.9% None (many diffs) n/a
8 ccsbBroad304_15351 pLX_304 0% 39.9% V5 (many diffs) n/a
9 ccsbBroadEn_13808 pDONR223 100% 39.9% None (many diffs) n/a
10 ccsbBroad304_13808 pLX_304 0% 39.9% V5 (not translated due to frame shift) (many diffs) n/a
11 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 39.9% V5 (not translated due to frame shift) (many diffs) n/a
12 ccsbBroadEn_05764 pDONR223 100% 39.8% None (many diffs) n/a
13 ccsbBroad304_05764 pLX_304 0% 39.8% V5 (many diffs) n/a
14 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 39.8% V5 (many diffs) n/a
Download CSV