Transcript: Human NR_027409.2

Homo sapiens golgin A8 family member A (GOLGA8A), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GOLGA8A (23015)
Length:
6868
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027409.2
NBCI Gene record:
GOLGA8A (23015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271395 CAGTTGAAGGAGTCGCTTAAA pLKO_005 3365 3UTR 100% 13.200 6.600 Y GOLGA8A n/a
2 TRCN0000162932 GCAGTTGGAGCAGCAAGTAAA pLKO.1 3844 3UTR 100% 13.200 6.600 Y GOLGA8B n/a
3 TRCN0000271336 TCAATCATACATTGCCTAAAT pLKO_005 6105 3UTR 100% 13.200 6.600 Y GOLGA8A n/a
4 TRCN0000284371 CAACGTTCATCGCAGCGTATA pLKO_005 3200 3UTR 100% 10.800 5.400 Y GOLGA8A n/a
5 TRCN0000271334 CACTTCTCAAGCGGCAGTTAG pLKO_005 3300 3UTR 100% 10.800 5.400 Y GOLGA8A n/a
6 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 3845 3UTR 100% 10.800 5.400 Y GOLGA6L9 n/a
7 TRCN0000271335 CAGCGAAGAGGAACACGAAAG pLKO_005 1714 3UTR 100% 6.000 3.000 Y GOLGA8A n/a
8 TRCN0000164118 CCGACAAGCATGGTGATCTTT pLKO.1 4308 3UTR 100% 5.625 2.813 Y GOLGA8A n/a
9 TRCN0000162621 CGACTGAATGACACCATCAAA pLKO.1 2972 3UTR 100% 5.625 2.813 Y GOLGA8A n/a
10 TRCN0000159025 GAAACTGGAACTTGGATTCAT pLKO.1 4018 3UTR 100% 5.625 2.813 Y GOLGA8B n/a
11 TRCN0000159068 GAGATCAATATGCTGAACAAA pLKO.1 3402 3UTR 100% 5.625 2.813 Y GOLGA8A n/a
12 TRCN0000163452 GCAGGAGGTTTGCACATTGAA pLKO.1 3469 3UTR 100% 5.625 2.813 Y GOLGA8A n/a
13 TRCN0000162211 CACATTGAAGGAGGAGAAGAA pLKO.1 3481 3UTR 100% 4.950 2.475 Y GOLGA8B n/a
14 TRCN0000160297 CATGAAACATTCTCTCAGATA pLKO.1 3142 3UTR 100% 4.950 2.475 Y GOLGA8A n/a
15 TRCN0000161746 CATGTGGAGAAACTGGAACTT pLKO.1 4010 3UTR 100% 4.950 2.475 Y GOLGA8A n/a
16 TRCN0000162146 CCAGAGATTGAACACAGAGAA pLKO.1 3094 3UTR 100% 4.950 2.475 Y GOLGA8A n/a
17 TRCN0000159069 GCAAACAATGAGAAACAGAAA pLKO.1 3047 3UTR 100% 4.950 2.475 Y GOLGA8A n/a
18 TRCN0000163257 GCACATTGAAGGAGGAGAAGA pLKO.1 3480 3UTR 100% 4.950 2.475 Y GOLGA8B n/a
19 TRCN0000153184 GTGGGAGTTCAAACACACAAA pLKO.1 4804 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
20 TRCN0000159735 GAGAGAGATCAATATGCTGAA pLKO.1 3398 3UTR 100% 4.050 2.025 Y GOLGA8B n/a
21 TRCN0000163726 GAGCATGTGGAGAAACTGGAA pLKO.1 4007 3UTR 100% 2.640 1.320 Y GOLGA8B n/a
22 TRCN0000161815 CATCAGAAAGTACATCGCCTT pLKO.1 4061 3UTR 100% 2.160 1.080 Y GOLGA8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07828 pDONR223 100% 26.2% None (many diffs) n/a
2 ccsbBroad304_07828 pLX_304 0% 26.2% V5 (many diffs) n/a
3 TRCN0000477056 CCAAAGGCACCTCCGCCCTGATCT pLX_317 21.8% 26.2% V5 (many diffs) n/a
4 ccsbBroadEn_10341 pDONR223 100% 15.2% None (many diffs) n/a
5 ccsbBroad304_10341 pLX_304 0% 15.2% V5 (many diffs) n/a
6 TRCN0000476380 AGTGATAACGTTCAAGGTCGCGGA pLX_317 28.7% 15.2% V5 (many diffs) n/a
7 ccsbBroadEn_16170 pDONR223 0% 15.1% None (many diffs) n/a
8 ccsbBroad304_16170 pLX_304 0% 15.1% V5 (many diffs) n/a
9 ccsbBroadEn_16172 pDONR223 0% 11.1% None (many diffs) n/a
10 ccsbBroad304_16172 pLX_304 0% 11.1% V5 (many diffs) n/a
11 TRCN0000480289 TACTAACTTATTTTTTGACAAACC pLX_317 100% 2.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV