Transcript: Human NR_028062.1

Homo sapiens protein kinase Y-linked (pseudogene) (PRKY), non-coding RNA.

Source:
NCBI, updated 2018-05-02
Taxon:
Homo sapiens (human)
Gene:
PRKY (5616)
Length:
7240
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028062.1
NBCI Gene record:
PRKY (5616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006343 CCTCGACAAGTCATGCTGTTT pLKO.1 2661 3UTR 100% 4.950 3.465 N PRKY n/a
2 TRCN0000199828 GAGATCGTCTACAGGGATTTG pLKO.1 840 3UTR 100% 10.800 6.480 N PRKY n/a
3 TRCN0000199518 GCTCTTCTACTCTGCGGAGAT pLKO.1 788 3UTR 100% 4.050 2.430 N PRKY n/a
4 TRCN0000199331 CACATCAAGCTCACGGACTTT pLKO.1 894 3UTR 100% 4.950 2.475 Y PRKY n/a
5 TRCN0000006345 CCGTTTGGCATTTATCAGAAA pLKO.1 1086 3UTR 100% 4.950 2.475 Y PRKY n/a
6 TRCN0000199818 GCCCTCAAGGTGATGAGCATT pLKO.1 567 3UTR 100% 4.950 2.475 Y PRKY n/a
7 TRCN0000199547 CAAGCATTTCTTCGCCCTCAA pLKO.1 554 3UTR 100% 4.050 2.025 Y PRKX n/a
8 TRCN0000199051 CCCGAAGTCATTCAGAGCAAG pLKO.1 978 3UTR 100% 4.050 2.025 Y PRKY n/a
9 TRCN0000006346 CGGCATCCTGATATTCGAGAT pLKO.1 1031 3UTR 100% 4.050 2.025 Y PRKY n/a
10 TRCN0000006344 CCCAGACATTTGGATTTCCAT pLKO.1 1131 3UTR 100% 3.000 1.500 Y PRKY n/a
11 TRCN0000199803 GCATCCTGATATTCGAGATGC pLKO.1 1033 3UTR 100% 0.405 0.203 Y PRKX n/a
12 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 5114 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492321 CCACCCCGTACCCCCTCTCATACC pLX_317 35.2% 13.3% V5 (many diffs) n/a
2 TRCN0000489271 AATAAATTAAACACGCAGCTCTCT pLX_317 32.9% 13.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14813 pDONR223 100% 13.2% None (many diffs) n/a
4 ccsbBroad304_14813 pLX_304 0% 13.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000480960 CTATCGAGCAAAAGCATGCGTCTC pLX_317 35.3% 13.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488775 AGGTTGATGTACACAACCACGGCC pLX_317 32% 13.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10492 pDONR223 100% 11.4% None 1_341del;1173_7240del n/a
8 ccsbBroad304_10492 pLX_304 0% 11.4% V5 1_341del;1173_7240del n/a
9 TRCN0000469989 AGTGTTCCTGGCGGATCAAGGCCA pLX_317 37.9% 11.4% V5 1_341del;451G>N;1173_7240del n/a
10 ccsbBroadEn_14814 pDONR223 100% 11.4% None (many diffs) n/a
11 ccsbBroad304_14814 pLX_304 0% 11.4% V5 (many diffs) n/a
Download CSV