Transcript: Human NR_033807.3

Homo sapiens cytochrome P450 family 3 subfamily A member 5 (CYP3A5), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CYP3A5 (1577)
Length:
3324
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033807.3
NBCI Gene record:
CYP3A5 (1577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064236 CCCTTGAAATTAGACACGCAA pLKO.1 3121 3UTR 100% 2.640 3.696 N CYP3A5 n/a
2 TRCN0000064237 CGTCAGGGTCTCTGGAAATTT pLKO.1 628 3UTR 100% 15.000 10.500 N CYP3A5 n/a
3 TRCN0000064234 GCAGTGTTCTTTCCTTCACTT pLKO.1 2636 3UTR 100% 4.950 3.465 N CYP3A5 n/a
4 TRCN0000064233 GCATTAAATGTCTCTCTGTTT pLKO.1 1322 3UTR 100% 4.950 3.465 N CYP3A5 n/a
5 TRCN0000064235 CCCATTGTTCTAAAGGTGGAT pLKO.1 3163 3UTR 100% 2.640 1.584 N CYP3A5 n/a
6 TRCN0000064020 CCTTACATATACACACCCTTT pLKO.1 2986 3UTR 100% 4.050 2.025 Y CYP3A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00412 pDONR223 100% 45.3% None (many diffs) n/a
2 ccsbBroad304_00412 pLX_304 0% 45.3% V5 (many diffs) n/a
3 TRCN0000468230 ATCAACTGGCCTGCGCCACCCCTT pLX_317 31.3% 45.3% V5 (many diffs) n/a
4 ccsbBroadEn_00411 pDONR223 100% 40.7% None (many diffs) n/a
5 ccsbBroad304_00411 pLX_304 0% 40.7% V5 (many diffs) n/a
6 TRCN0000477588 ATCTATTATTTATGACGGCGACCT pLX_317 35.4% 40.7% V5 (many diffs) n/a
7 ccsbBroadEn_06073 pDONR223 100% 40.4% None (many diffs) n/a
8 ccsbBroad304_06073 pLX_304 0% 40.4% V5 (many diffs) n/a
9 TRCN0000470575 CTAAAATCTCGCTGGTGGCATAGC pLX_317 30.2% 40.4% V5 (many diffs) n/a
Download CSV