Transcript: Human NR_120608.2

Homo sapiens tubulin beta class I (TUBB), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
TUBB (203068)
Length:
1916
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_120608.2
NBCI Gene record:
TUBB (203068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_120608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074361 GCAGTCACCTTCATTGGCAAT pLKO.1 646 3UTR 100% 4.050 5.670 N TUBB n/a
2 TRCN0000311653 GCAGTCACCTTCATTGGCAAT pLKO_005 646 3UTR 100% 4.050 5.670 N TUBB n/a
3 TRCN0000074359 CGCATCTCTGTGTACTACAAT pLKO.1 291 3UTR 100% 5.625 3.938 N TUBB n/a
4 TRCN0000311722 CGCATCTCTGTGTACTACAAT pLKO_005 291 3UTR 100% 5.625 3.938 N TUBB n/a
5 TRCN0000074358 GCGCTCAATAAATACTTGTTT pLKO.1 1046 3UTR 100% 5.625 3.375 N TUBB n/a
6 TRCN0000311723 GCGCTCAATAAATACTTGTTT pLKO_005 1046 3UTR 100% 5.625 3.375 N TUBB n/a
7 TRCN0000074360 GCAGATGCTTAACGTGCAGAA pLKO.1 540 3UTR 100% 4.050 2.430 N TUBB n/a
8 TRCN0000311652 GCAGATGCTTAACGTGCAGAA pLKO_005 540 3UTR 100% 4.050 2.430 N TUBB n/a
9 TRCN0000089932 GCAGAACAAGAACAGCAGCTA pLKO.1 555 3UTR 100% 2.640 1.320 Y Tubb2a n/a
10 TRCN0000089724 GACAACTTTGTATTTGGTCAA pLKO.1 417 3UTR 100% 4.050 2.835 N Tubb4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_120608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05206 pDONR223 100% 29.1% None 1_155del;431_432ins599;889_1916del n/a
2 ccsbBroad304_05206 pLX_304 0% 29.1% V5 1_155del;431_432ins599;889_1916del n/a
3 ccsbBroadEn_02416 pDONR223 100% 24.9% None (many diffs) n/a
4 ccsbBroad304_02416 pLX_304 0% 24.9% V5 (many diffs) n/a
5 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 24.9% V5 (many diffs) n/a
6 ccsbBroadEn_07109 pDONR223 100% 24.9% None (many diffs) n/a
7 ccsbBroad304_07109 pLX_304 0% 24.9% V5 (many diffs) n/a
8 TRCN0000470494 CAATTACAACATTCATCTATATAC pLX_317 29.5% 24.9% V5 (many diffs) n/a
9 ccsbBroadEn_13398 pDONR223 100% 19.4% None 1_516del;889_1916del n/a
10 ccsbBroad304_13398 pLX_304 0% 19.4% V5 1_516del;889_1916del n/a
11 TRCN0000466902 ACCACAGTACACCCTTGCTTCGCA pLX_317 100% 19.4% V5 1_516del;889_1916del n/a
Download CSV